Maxwell RSC Instrument from Promega

Product Specs
ItemMaxwell RSC Instrument
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberAS4500
QuantityEA
Processing Time30 to 60 min (depending on sample type and method)
CapacityUp to 16
Dimensions(WxDxH) 330.2 x 345.2 x 299.7 mm (13 x 13.6 x 11.8 in)
UV LampAvg. lifetime approximately 6,000 hrs
Molecular Weight~85kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(561) Sensitive and Specific qPCR and Nested RT-PCR Assays for the Detection of Tobacco Streak Virus in SoybeanPhytoFrontiers™December 1, 2021Cristina Zambrana-Echevarría, Mitchell G. Roth, Ranjit Dasgupta, Thomas L. German, Carol L. Groves, Damon L. SmithTRIzol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA, U.S.A.) or the Maxwell RSC Plant RNA kit with the automated Maxwell RSC Instrument (Promega Corp., Madison, WI, U.S.A.) according to the manufacturers’ instructions. RNA quantity was

(562) TP53 mutations are associated with primary endocrine resistance in luminal early breast cancerCancer MedicineDecember 1, 2021Isabel Grote et al.µm) were taken. Genomic DNA was extracted from FFPE specimens with the Maxwell® RSC DNA FFPE Kit on a Maxwell® RSC instrument (Promega) according to the manufacturer's recommendations. DNA concentration was quantified using a

(563) Weaving Mitochondrial DNA and Y-Chromosome Variation in the Panamanian Genetic CanvasGenes (Basel)November 29, 2021Nicola Rambaldi Migliore, Giulia Colombo, Marco Rosario Capodiferro, Lucia Mazzocchi, Ana Maria Chero Osorio, Alessandro Raveane, Maribel Tribaldos, Ugo Alessandro Perego, TomÃ¡s MendizÃ¡bal, Alejandro GarcÃa MontÃ³n, et al.either following a standard phenol/chloroform protocol or with automated extraction performed with the Maxwell® RSC Instrument from Promega Italia srl (Milan, Italy) according to the manufacturer’s protocol. 2.2. Mitochondrial

(564) Variant profiling of colorectal adenomas from three patients of two families with MSH3-related adenomatous polyposisPLOS ONENovember 29, 2021Claudia Perne et al.isolation of genomic DNA was performed post-deparaffinisation using the Maxwell RSC DNA Kit and the Maxwell RSC instrument (Promega, Fitchburg WI, U.S.A.). To reduce FFPE-induced sequencing artifacts, an FFPE repair kit was

(565) LTBP3 Frameshift Variant in British Shorthair Cats with Complex Skeletal DysplasiaGenes (Basel)November 29, 2021Gabriela Rudd Garces, Anna Knebel, Kirsten Hülskötter, Vidhya Jagannathan, Theresa Störk, Marion Hewicker-Trautwein, Tosso Leeb, Holger A. Volkfrom 500 μL EDTA blood samples of the cats in the study with the Maxwell RSC Whole Blood Kit, using a Maxwell RSC instrument (Promega, Dübendorf, Switzerland). 2.6. Whole Genome Sequencing of an Affected Kitten An Illumina

(566) LAMA2 Nonsense Variant in an Italian Greyhound with Congenital Muscular DystrophyGenes (Basel)November 19, 2021Matthias Christen, Victoria Indzhova, Ling T. Guo, Vidhya Jagannathan, Tosso Leeb, G. Diane Shelton, Josep BrocalItalian Greyhounds. Genomic DNA was isolated from EDTA blood with the Maxwell RSC Whole Blood Kit using a Maxwell RSC instrument (Promega, Dübendorf, Switzerland). 2.4. Whole-Genome Sequencing An Illumina TruSeq PCR-free DNA library

(567) Geographic Variations in Test Reactivity for the Serological Diagnosis of Trypanosoma cruzi InfectionJournal of Clinical MicrobiologyNovember 18, 2021Carine Truyens, Eric Dumonteil, Jackeline Alger, Maria Luisa Cafferata, Alvaro Ciganda, Luz Gibbons, Claudia Herrera, Sergio Sosa-Estani, Pierre BuekensDNA was extracted from 300 μl of blood conserved in 6 M guanidine HCl, 0.2 M EDTA using an automated Maxwell RSC instrument (Promega Benelux, Leiden, The Netherland) as described previously (13). All DNA extractions and PCR assays

(568) Immunological Characterization of HIV and SARS-CoV-2 Coinfected Young IndividualsCellsNovember 16, 2021Claudia Vanetti et al.Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, Fitchburg, WI, USA) was used to extract SARS-CoV-2 RNA using the Maxwell® RSC Instrument (Promega, Fitchburg, WI, USA). Viral RNA was quantified as previously described [9]. Briefly, a single-step

(569) A direct capture method for purification and detection of viral nucleic acid enables epidemiological surveillance of SARS-CoV-2Science of The Total EnvironmentNovember 15, 2021Subhanjan Mondal, Nathan Feirer, Michael Brockman, Melanie A. Preston, Sarah J. Teter, Dongping Ma, Said A. Goueli, Sameer Moorji, Brigitta Saul, James J. Calinucleic acid purification was performed using Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corp.) using the Maxwell® RSC Instrument (Promega Corp.) according to a modified version of manufacturer's protocol. Briefly, to 200 μL of wastewater

(570) Glucocorticoids Induce Partial Remission of Focal Segmental Glomerulosclerosis but Not Interstitial Nephritis in COVID-19 Acute Kidney Injury in an APOL1 Low-Risk Genotype White PatientAmerican Journal of Case ReportsNovember 2, 2021Piotr J. Nowak, Joanna Forycka, Natalia Cegielska, Karolina Harendarz, MaÅ‚gorzata WÄ…growska-Danilewicz, Marian Danilewicz, Tomasz PÅ‚oszaj, Maciej Borowiec, RafaÅ‚ WlazeÅ‚, MichaÅ‚ Nowickithe gene sequence matched the hg19 reference sequence. DNA was isolated from peripheral blood using a Maxwell® RSC instrument (Promega). Fragments of APOL1 gene (chr22: 36661747-36662448; 702bp) were amplified using forward GCCAGAGCCAATCTTCAGTC

(571) Liquid biopsy with droplet digital PCR targeted to specific mutations in plasma cell-free tumor DNA can detect ovarian cancer recurrence earlier than CA125Gynecologic Oncology ReportsNovember 1, 2021Takamichi Minato, Shin Ito, Bin Li, Haruna Fujimori, Mai Mochizuki, Kazunori Yamaguchi, Keiichi Tamai, Muneaki Shimada, Hideki Tokunaga, Shogo Shigeta, et al.DNA was extracted with the Maxwell RSC DNA FFPE Kit- PKK, Custom (AX2500; Promega, Madison, WI) and Maxwell RSC Instrument (Promega) according to the manufacturer's instructions. In total, 590 ng to 4,480 ng whole genomic DNA

(572) Hepatoblastoma: glutamine depletion hinders cell viability in the embryonal subtype but high GLUL expression is associated with better overall survivalJournal of cancer research and clinical oncologyNovember 1, 2021Schmidt A, Armento A, Bussolati O, Chiu M, Ellerkamp V, Scharpf MO, Sander P, Schmid E, Warmann SW, Fuchs J.was extracted from macro-dissected 5 µm paraffin sections using the Maxwell® RSC DNA FFPE Kit and the Maxwell® RSC Instrument (Promega, Madison, WI, USA) according to the manufacturer’s instructions. CTNNB1 exon 3 was investigated

(573) SARS-CoV-2 Exposed Mesenchymal Stromal Cell from Congenital Pulmonary Airway Malformations: Transcriptomic Analysis and the Expression of Immunomodulatory GenesInternational Journal of Molecular SciencesOctober 30, 2021Andrea Valeri et al.investigate the cytopathic effect. SARS-CoV-2 RNA was extracted from 24, 48, and 72 hpi supernatant using the Maxwell® RSC Instrument with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, Fitchburg, WI, USA). Viral RNA

(574) EphA2 Expression in Bone Sarcomas: Bioinformatic Analyses and Preclinical Characterization in Patient-Derived Models of Osteosarcoma, Ewing's Sarcoma and ChondrosarcomaCellsOctober 26, 2021Giordano G, Merlini A, Ferrero G, Mesiano G, Fiorino E, Brusco S, Centomo ML, Leuci V, D'Ambrosio L, Aglietta M, et al.tissue and normal counterparts upon homogenization by using Promega a Maxwell RSC miRNA tissue Kit and a Maxwell RSC Instrument (Promega Italia, MI, Italy). RNA quality and concentration were checked by DS 11+ Spectrophotometer

(575) A multiplexed ion-exchange membrane-based miRNA (MIX·miR) detection platform for rapid diagnosis of myocardial infarctionLab on a ChipOctober 12, 2021Xiang Ren, Bradley W. Ellis, George Ronan, Stuart Ryan Blood, Cameron DeShetler, Satyajyoti Senapati, Keith L. March, Eileen Handberg, David Anderson, Carl Pepine, et al.aliquoted and stored at −20°C. miRNA isolation for RT-qPCR miRNA was isolated from human plasma using the Maxwell RSC instrument (Promega, Wisconsin, USA) and miRNA Plasma or Serum miRNA isolation kit (Promega) with lysing solution

(576) Genetic evaluation of small ruminant lentivirus susceptibility in Valais blacknose sheepAnimal GeneticsOctober 1, 2021Anna Letko, Charis BÃ¼tzberger, Nathalie Hirter, Julia M. Paris, Carlos Abril, Cord DrÃ¶gemÃ¼llerReinach, Switzerland). Therefore, genomic DNA was extracted from EDTA‐stabilized blood samples using the Maxwell RSC instrument (Promega, Dübendorf, Switzerland). Interestingly, no homozygous wild type genotypes were observed for

(577) An alternative approach for bioanalytical assay optimization for wastewater-based epidemiology of SARS-CoV-2Science of The Total EnvironmentOctober 1, 2021Tim Boogaerts, Lotte Jacobs, Naomi De Roeck, Siel Van den Bogaert, Bert Aertgeerts, Lies Lahousse, Alexander L.N. van Nuijs, Peter DelputtePowermicrobiome kit were obtained from QIAGEN (Hilden, DE). Automated RNA extraction was done with the Maxwell® RSC Instrument with the PureFood GMO and Authentication kit, both from Promega (Madison, US). Initially, a selection

(578) The long non-coding RNA HOTAIRM1 promotes tumor aggressiveness and radiotherapy resistance in glioblastomaCell Death & DiseaseOctober 1, 2021Ulvi Ahmadov et al.quantitative PCR Total RNA extraction was performed by using TRIzol (#15596026, Thermo Fischer Scientific) or by using a Maxwell RSC instrument (#AS1340, RSC simplyRNA Tissue, Promega, Madison, WI, USA). Reverse transcription of total RNA (1 µg)

(579) Variants in COMT, CYP3A5, CYP2B6, and ABCG2 Alter Quetiapine PharmacokineticsPharmaceuticsSeptember 28, 2021Pablo Zubiaur, Paula FernÃ¡ndez-Campos, Marcos Navares-GÃ³mez, Paula Soria-Chacartegui, Gonzalo Villapalos-GarcÃa, Manuel RomÃ¡n, Gina MejÃa-Abril, Dolores Ochoa, Francisco Abad-Santosstudy. 2.3. Genotyping, Haplotyping, and Phenotyping DNA was extracted from peripheral blood in a Maxwell® RSC Instrument (Promega Biotech Ibérica S.L., Alcobendas, Madrid, Spain). Genotyping was performed by real-time quantitative

(580) Molecular phylogenetic analysis of bovine papular stomatitis viruses detected in Saga, JapanJournal of Veterinary Medical ScienceSeptember 27, 2021Shinji HIRANO, Yasufumi SOGA, Yuri KUNO, Satomi DOAI, Shinya TOKUTAKE, Tomoyuki SHIBAHARA, Tadahiro INDOhomogenates using a Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI, USA) with a Maxwell RSC Instrument (Promega), according to the manufacturer’s instructions. PCR was performed with AmpliTaq Gold (Applied

Be the First to Write a Review!