Maxwell RSC Instrument from Promega

Product Specs
ItemMaxwell RSC Instrument
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberAS4500
QuantityEA
Processing Time30 to 60 min (depending on sample type and method)
CapacityUp to 16
Dimensions(WxDxH) 330.2 x 345.2 x 299.7 mm (13 x 13.6 x 11.8 in)
UV LampAvg. lifetime approximately 6,000 hrs
Molecular Weight~85kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(601) Immunological Characterization of HIV and SARS-CoV-2 Coinfected Young IndividualsCellsNovember 16, 2021Claudia Vanetti et al.Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, Fitchburg, WI, USA) was used to extract SARS-CoV-2 RNA using the Maxwell® RSC Instrument (Promega, Fitchburg, WI, USA). Viral RNA was quantified as previously described [9]. Briefly, a single-step

(602) A direct capture method for purification and detection of viral nucleic acid enables epidemiological surveillance of SARS-CoV-2Science of The Total EnvironmentNovember 15, 2021Subhanjan Mondal, Nathan Feirer, Michael Brockman, Melanie A. Preston, Sarah J. Teter, Dongping Ma, Said A. Goueli, Sameer Moorji, Brigitta Saul, James J. Calinucleic acid purification was performed using Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corp.) using the Maxwell® RSC Instrument (Promega Corp.) according to a modified version of manufacturer's protocol. Briefly, to 200 μL of wastewater

(603) Glucocorticoids Induce Partial Remission of Focal Segmental Glomerulosclerosis but Not Interstitial Nephritis in COVID-19 Acute Kidney Injury in an APOL1 Low-Risk Genotype White PatientAmerican Journal of Case ReportsNovember 2, 2021Piotr J. Nowak, Joanna Forycka, Natalia Cegielska, Karolina Harendarz, MaÅ‚gorzata WÄ…growska-Danilewicz, Marian Danilewicz, Tomasz PÅ‚oszaj, Maciej Borowiec, RafaÅ‚ WlazeÅ‚, MichaÅ‚ Nowickithe gene sequence matched the hg19 reference sequence. DNA was isolated from peripheral blood using a Maxwell® RSC instrument (Promega). Fragments of APOL1 gene (chr22: 36661747-36662448; 702bp) were amplified using forward GCCAGAGCCAATCTTCAGTC

(604) Glucocorticoids Induce Partial Remission of Focal Segmental Glomerulosclerosis but Not Interstitial Nephritis in COVID-19 Acute Kidney Injury in an APOL1 Low-Risk Genotype White PatientAm J Case RepNovember 2, 2021Piotr J. Nowak, Joanna Forycka, Natalia Cegielska, Karolina Harendarz, Małgorzata Wągrowska-Danilewicz, Marian Danilewicz, Tomasz Płoszaj, Maciej Borowiec, Rafał Wlazeł, Michał Nowickithe gene sequence matched the hg19 reference sequence. DNA was isolated from peripheral blood using a Maxwell® RSC instrument (Promega). Fragments of APOL1 gene (chr22: 36661747-36662448; 702bp) were amplified using forward GCCAGAGCCAATCTTCAGTC

(605) Liquid biopsy with droplet digital PCR targeted to specific mutations in plasma cell-free tumor DNA can detect ovarian cancer recurrence earlier than CA125Gynecologic Oncology ReportsNovember 1, 2021Takamichi Minato, Shin Ito, Bin Li, Haruna Fujimori, Mai Mochizuki, Kazunori Yamaguchi, Keiichi Tamai, Muneaki Shimada, Hideki Tokunaga, Shogo Shigeta, et al.DNA was extracted with the Maxwell RSC DNA FFPE Kit- PKK, Custom (AX2500; Promega, Madison, WI) and Maxwell RSC Instrument (Promega) according to the manufacturer's instructions. In total, 590 ng to 4,480 ng whole genomic DNA

(606) Hepatoblastoma: glutamine depletion hinders cell viability in the embryonal subtype but high GLUL expression is associated with better overall survivalJournal of cancer research and clinical oncologyNovember 1, 2021Schmidt A, Armento A, Bussolati O, Chiu M, Ellerkamp V, Scharpf MO, Sander P, Schmid E, Warmann SW, Fuchs J.was extracted from macro-dissected 5 µm paraffin sections using the Maxwell® RSC DNA FFPE Kit and the Maxwell® RSC Instrument (Promega, Madison, WI, USA) according to the manufacturer’s instructions. CTNNB1 exon 3 was investigated

(607) SARS-CoV-2 Exposed Mesenchymal Stromal Cell from Congenital Pulmonary Airway Malformations: Transcriptomic Analysis and the Expression of Immunomodulatory GenesInternational Journal of Molecular SciencesOctober 30, 2021Andrea Valeri et al.investigate the cytopathic effect. SARS-CoV-2 RNA was extracted from 24, 48, and 72 hpi supernatant using the Maxwell® RSC Instrument with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, Fitchburg, WI, USA). Viral RNA

(608) EphA2 Expression in Bone Sarcomas: Bioinformatic Analyses and Preclinical Characterization in Patient-Derived Models of Osteosarcoma, Ewing's Sarcoma and ChondrosarcomaCellsOctober 26, 2021Giordano G, Merlini A, Ferrero G, Mesiano G, Fiorino E, Brusco S, Centomo ML, Leuci V, D'Ambrosio L, Aglietta M, et al.tissue and normal counterparts upon homogenization by using Promega a Maxwell RSC miRNA tissue Kit and a Maxwell RSC Instrument (Promega Italia, MI, Italy). RNA quality and concentration were checked by DS 11+ Spectrophotometer

(609) A multiplexed ion-exchange membrane-based miRNA (MIX·miR) detection platform for rapid diagnosis of myocardial infarctionLab on a ChipOctober 12, 2021Xiang Ren, Bradley W. Ellis, George Ronan, Stuart Ryan Blood, Cameron DeShetler, Satyajyoti Senapati, Keith L. March, Eileen Handberg, David Anderson, Carl Pepine, et al.aliquoted and stored at −20°C. miRNA isolation for RT-qPCR miRNA was isolated from human plasma using the Maxwell RSC instrument (Promega, Wisconsin, USA) and miRNA Plasma or Serum miRNA isolation kit (Promega) with lysing solution

(610) Genetic evaluation of small ruminant lentivirus susceptibility in Valais blacknose sheepAnimal GeneticsOctober 1, 2021Anna Letko, Charis BÃ¼tzberger, Nathalie Hirter, Julia M. Paris, Carlos Abril, Cord DrÃ¶gemÃ¼llerReinach, Switzerland). Therefore, genomic DNA was extracted from EDTA‐stabilized blood samples using the Maxwell RSC instrument (Promega, Dübendorf, Switzerland). Interestingly, no homozygous wild type genotypes were observed for

(611) An alternative approach for bioanalytical assay optimization for wastewater-based epidemiology of SARS-CoV-2Science of The Total EnvironmentOctober 1, 2021Tim Boogaerts, Lotte Jacobs, Naomi De Roeck, Siel Van den Bogaert, Bert Aertgeerts, Lies Lahousse, Alexander L.N. van Nuijs, Peter DelputtePowermicrobiome kit were obtained from QIAGEN (Hilden, DE). Automated RNA extraction was done with the Maxwell® RSC Instrument with the PureFood GMO and Authentication kit, both from Promega (Madison, US). Initially, a selection

(612) The long non-coding RNA HOTAIRM1 promotes tumor aggressiveness and radiotherapy resistance in glioblastomaCell Death & DiseaseOctober 1, 2021Ulvi Ahmadov et al.quantitative PCR Total RNA extraction was performed by using TRIzol (#15596026, Thermo Fischer Scientific) or by using a Maxwell RSC instrument (#AS1340, RSC simplyRNA Tissue, Promega, Madison, WI, USA). Reverse transcription of total RNA (1 µg)

(613) Variants in COMT, CYP3A5, CYP2B6, and ABCG2 Alter Quetiapine PharmacokineticsPharmaceuticsSeptember 28, 2021Pablo Zubiaur, Paula FernÃ¡ndez-Campos, Marcos Navares-GÃ³mez, Paula Soria-Chacartegui, Gonzalo Villapalos-GarcÃa, Manuel RomÃ¡n, Gina MejÃa-Abril, Dolores Ochoa, Francisco Abad-Santosstudy. 2.3. Genotyping, Haplotyping, and Phenotyping DNA was extracted from peripheral blood in a Maxwell® RSC Instrument (Promega Biotech Ibérica S.L., Alcobendas, Madrid, Spain). Genotyping was performed by real-time quantitative

(614) Molecular phylogenetic analysis of bovine papular stomatitis viruses detected in Saga, JapanJournal of Veterinary Medical ScienceSeptember 27, 2021Shinji HIRANO, Yasufumi SOGA, Yuri KUNO, Satomi DOAI, Shinya TOKUTAKE, Tomoyuki SHIBAHARA, Tadahiro INDOhomogenates using a Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI, USA) with a Maxwell RSC Instrument (Promega), according to the manufacturer’s instructions. PCR was performed with AmpliTaq Gold (Applied

(615) MIA3 Splice Defect in Cane Corso Dogs with Dental-Skeletal-Retinal Anomaly (DSRA)Genes (Basel)September 25, 2021Matthias Christen, HenriÃ«tte Booij-Vrieling, Jelena Oksa-Minalto, Cynthia de Vries, Alexandra Kehl, Vidhya Jagannathan, Tosso LeebGenotyping Genomic DNA was isolated from EDTA blood samples with the Maxwell RSC Whole Blood DNA Kit using a Maxwell RSC instrument (Promega, Dübendorf, Switzerland). DNA from 12 affected and 8 unaffected animals was genotyped on illumina_HD

(616) PRKG2 Splice Site Variant in Dogo Argentino Dogs with Disproportionate DwarfismGenes (Basel)September 24, 2021Gabriela Rudd Garces, Maria Elena Turba, Myriam Muracchini, Alessia Diana, Vidhya Jagannathan, Fabio Gentilini, Tosso LeebDNA Isolation Genomic DNA was isolated from EDTA blood with the Maxwell RSC Whole Blood Kit using a Maxwell RSC instrument (Promega, Dübendorf, Switzerland). 2.3. Linkage and Homozygosity Mapping The Dogo Argentino family,

(617) MYO5A Frameshift Variant in a Miniature Dachshund with Coat Color Dilution and Neurological Defects Resembling Human Griscelli Syndrome Type 1Genes (Basel)September 23, 2021Matthias Christen, Madeleine de le Roi, Vidhya Jagannathan, Kathrin Becker, Tosso LeebExtraction Genomic DNA was isolated from the EDTA blood with the Maxwell RSC Whole Blood Kit using a Maxwell RSC instrument (Promega, Dübendorf, Switzerland). 2.5. Whole-Genome Sequencing An Illumina TruSeq PCR-free DNA library

(618) Analysis of Telomere Maintenance Related Genes Reveals NOP10 as a New Metastatic-Risk Marker in Pheochromocytoma/ParagangliomaCancers (Basel)September 23, 2021María Monteagudo et al.samples using the Maxwell® RSC DNA Formalin-fixed paraffin embedded Kit (Promega, Madison, WI, USA) and a Maxwell® RSC Instrument (Promega). DNA from frozen tissue was extracted with DNeasy® Blood and Tissue Kit (Qiagen, Hilden, Germany),

(619) Prolyl isomerase Pin1 plays an essential role in SARS-CoV-2 proliferation, indicating its possibility as a novel therapeutic targetScientific reportsSeptember 17, 2021Yamamotoya T, Nakatsu Y, Kanna M, Hasei S, Ohata Y, Encinas J, Ito H, Okabe T, Asano T, Sakaguchi T.Sendai, Japan) as a standard. Cellular RNA in the infected VeroE6/TMPRSS2 cells was prepared using the Maxwell RSC instrument (Promega Corp., Madison, WI) according to the manufacturer’s protocol. RT-qPCR for specific amplification

(620) PD-L1 Dependent Immunogenic Landscape in Hot Lung Adenocarcinomas Identified by Transcriptome AnalysisCancers (Basel)September 11, 2021Jutta Kirfel et al.mRNA isolation and quantification were performed using the Maxwell RSC RNA FFPE Kit together with the Maxwell RSC instrument (Promega, Fitchburg, WI, USA) and the Qubit fluorimeter (ThermoFisher, Waltham, MA, USA), respectively.

Be the First to Write a Review!