pRL-SV40 Vector from Promega

Product Specs
ItempRL-SV40 Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2231
HostMammalian
ResistanceAmpR
PromoterSV40 early enhancer/promoter
Vector NamepRL-SV40
Quantity20microg
ReporterRenilla luciferase
Molecular Weight~73kDa
Selectable MarkerAmpicillin

Specifications/Features

Vector Size:
3705 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(221) An integrative pharmacogenomics analysis identifies therapeutic targets in KRAS-mutant lung cancerEBioMedicineOctober 23, 2019Haiyun Wang, Qi Lv, Yue Xu, Zhaoqing Cai, Jie Zheng, Xiaojie Cheng, Yao Dai, Pasi A. Jänne, Chiara Ambrogio, Jens KöhlerSuper 8x TOPFlash reporter plasmid, 100 ng of a pRL Renilla Luciferase control vector (Promega Cat#E2231) and FuGENE® HD (Promega Cat#PRE2311). M50 Super 8x TOPFlash was a gift from Randall Moon (Addgene plasmid

(222) microRNA-17 functions as an oncogene by downregulating Smad3 expression in hepatocellular carcinomaCell Death & DiseaseOctober 1, 2019Zhufeng Lu, Xiuhua Li, Yongfeng Xu, Miaomiao Chen, Wei Chen, Tao Chen, Qinghe Tang, Zhiying HeNC oligonucleotides (GenePharma, Shanghai), 20 ng luciferase reporter plasmids and 10 ng of pRL-TK (E2231, Promega) by the transfection reagent INTERFERin (89129-130, Polyplus transfection). The sequences of

(223) Single Nucleotide Polymorphisms at a Distance from Aryl Hydrocarbon Receptor (AHR) Binding Sites Influence AHR Ligand–Dependent Gene ExpressionDrug Metabolism and DispositionSeptember 1, 2019Drew R. Neavin, Jeong-Heon Lee, Duan Liu, Zhenqing Ye, Hu Li, Liewei Wang, Tamas Ordog, Richard M. Weinshilboumcotransfected into cells with a 1:10 ratio of pRL renilla, which was used as a transfection control vector (E2231; Promega). Thermo Fisher Scientific (Morristown, NJ) Lipofectamine 3000 or Lipofectamine 2000 (HMC3

(224) miR-640 aggravates intervertebral disc degeneration via NF-κB and WNT signalling pathwayCell proliferationSeptember 1, 2019Dong W, Liu J, Lv Y, Wang F, Liu T, Sun S, Liao B, Shu Z, Qian J.alone or in combination with 30 nmol/L miR‐640 precursors or inhibitors. 0.8 μg of pRL vector (Promega, E2231) was transfected to each well simultaneously. After 24 hours, we measured firefly luciferase (FLuc)

(225) Loss of Ataxin-1 Potentiates Alzheimer's Pathogenesis by Elevating Cerebral BACE1 TranscriptionCellAugust 22, 2019Suh J, Romano DM, Nitschke L, Herrick SP, DiMarzio BA, Dzhala V, Bae JS, Oram MK, Zheng Y, Hooli B, et al.Deletion:CCTCTCCAGCCCAGCCGGATTGCC, Recombinant DNA,Recombinant DNA,Recombinant DNA pGL3-Basic Vector,Promega,Cat# E1751 pRL-TK,Promega,Cat# E2231 pLX_TRC311,Addgene,Cat# 113668 pLX_TRC311 ETV4-S,Addgene,Cat# 74983 pLX_TRC311 ETV4-L,Addgene,Cat#

(226) Androgen Receptor-Activated Enhancers Simultaneously Regulate Oncogene TMPRSS2 and lncRNA PRCAT38 in Prostate CancerCellsAugust 9, 2019Chen Z, Song X, Li Q, Xie L, Guo T, Su T, Tang C, Chang X, Liang B, Huang D.molecular cloning are listed in Supplementary Table S4. The control pRL-SV40 Vector was purchased from Promega (E2231). All engineered constructs were verified by sequencing. Plasmid transfection was performed with a FuGENE HD transfection reagent

(227) TDP-43 regulates early-phase insulin secretion via CaV1.2-mediated exocytosis in isletsThe Journal of clinical investigationJuly 29, 2019Araki K, Araki A, Honda D, Izumoto T, Hashizume A, Hijikata Y, Yamada S, Iguchi Y, Hara A, Ikumi K, et al.plasmid constructs were made using the backbone of the pGL3-Basic reporter vector and pRL-TK vector (E2231, Promega). To clone the 5′-flanking region of mouse Cacna1c as a putative promoter region, the following

(228) Switch-like enhancement of epithelial-mesenchymal transition by YAP through feedback regulation of WT1 and Rho-family GTPasesNature communicationsJune 26, 2019Park J, Kim DH, Shah SR, Kim HN, Kshitiz, Kim P, Quiñones-Hinojosa A, Levchenko A.Addgene (#42081). Also, as a control reporter, we used pRL-Renilla luciferase control reporter vectors (E2231, Promega). For the assay, we used luciferase assay kit (E1500 and E2810) following the manufacturer’s

(229) Overexpression of zinc finger protein 384 (ZNF 384), a poor prognostic predictor, promotes cell growth by upregulating the expression of Cyclin D1 in Hepatocellular carcinomaCell Death & DiseaseJune 1, 2019Lifeng He, Xiaoxiao Fan, Yirun Li, Mingming Chen, Bin Cui, Guoqiao Chen, Yili Dai, Daizhan Zhou, Xiaotong Hu, Hui Linwas normalized to that of cells co-transfected with the pRL Renilla expression vector (Promega, cat#E2231). Lysates were analyzed with a dual luciferase kit (Promega, cat#E1980). Chromatin immunoprecipitation

(230) Aberrant activation of CYR61 enhancers in colorectal cancer developmentJournal of experimental & clinical cancer research : CRMay 22, 2019Xie L, Song X, Lin H, Chen Z, Li Q, Guo T, Xu T, Su T, Xu M, Chang X, et al.detect putative enhancer activity. The pGL3-basic Vector (Promega, E1751) and pRL-SV40 Vector (Promega, E2231) were purchased. The pGL3-basic-promoter plasmid was constructed by inserting the CYR61 promoter region

(231) Loss of Sirtuin 1 Alters the Secretome of Breast Cancer Cells by Impairing Lysosomal IntegrityDevelopmental cellMay 6, 2019Latifkar A, Ling L, Hingorani A, Johansen E, Clement A, Zhang X, Hartman J, Fischbach C, Lin H, Cerione RA, et al.pGL3-Luciferase reporter vector (E1751), and for transfection efficiency normalization the pRL-Renilla reporter (E2231) was purchased from Promega. All shRNA constructs were from Sigma. Lentiviruses were generated by transfecting

(232) Modular Architecture of the STING C-Terminal Tail Allows Interferon and NF-κB Signaling AdaptationCell reportsApril 23, 2019de Oliveira Mann CC, Orzalli MH, King DS, Kagan JC, Lee ASY, Kranzusch PJ.paper,N/A pcDNA4-human-cGAS,Philip Kranzusch Laboratory,N/A pGL3-2 × IFNβ-FLuc,Jae Jung Laboratory,N/A pRL-TK,Promega,Cat# E2231 pGL2-ELAM-NF-κB-FLuc,Russell Vance Laboratory,N/A pLuc-IFNβ-110,Kate Fitzgerald Laboratory,N/A pLuc-PRD(III-I)3,Kate

(233) Hypomethylation at non-CpG/CpG sites in the promoter of HIF-1α gene combined with enhanced H3K9Ac modification contribute to maintain higher HIF-1α expression in breast cancerOncogenesisApril 2, 2019Chun Li, Wei Xiong, Xiong Liu, Wenjun Xiao, Yuxian Guo, Junyu Tan, Yaochen Liwere normalized to Renilla luciferase luminescence derived from the co-transfected pRL-SV40 vector (E2231, Promega, Madison, WI, USA). Chromatin immunoprecipitation (ChIP) and ChIP-qPCR To determine whether

(234) A Scalable, Multiplexed Assay for Decoding GPCR-Ligand Interactions with RNA SequencingCell SystemsMarch 20, 2019Eric M. Jones et al.S4,, Recombinant DNA,Recombinant DNA,Recombinant DNA pCRE-Luc,Stratagene,219076 pRL-SV40,Promega,E2231 pCI,Promega,E1731 Super PiggyBac Transposase,Systems Bioscience,PB210PA-1 ,, Software and Algorithms,Software

(235) Constant Degradation of the Androgen Receptor by MDM2 Conserves Prostate Cancer Stem Cell IntegrityCancer ResearchMarch 15, 2019Premkumar Vummidi Vummidi Giridhar, Karin Williams, Andrew P. VonHandorf, Paul L. Deford, Susan Kasperwere transfected with the ARR2PB-luc reporter (20) and Renilla luciferase vectors (Promega, cat.#: E2231) and either treated with increasing concentrations of MG132 (to induce endogenous AR) or co-transfected

(236) In Silico Identification and Experimental Validation of (−)-Muqubilin A, a Marine Norterpene Peroxide, as PPARα/γ-RXRα Agonist and RARα Positive Allosteric ModulatorMarine DrugsFebruary 12, 2019Enrico D’Aniello et al.300 ng of TK-MH100x4-Luc containing the UAS enhancer elements, 25 ng of Renilla Luciferase (pRL, cat. E2231; Promega, Milan, Italy), and 150 ng pcDNA3 (Thermo Fisher Scientific, Milan, Italy) empty vector to

(237) Herpes Simplex Virus 1 ICP22 Suppresses CD80 Expression by Murine Dendritic CellsJournal of virologyFebruary 1, 2019Matundan H, Ghiasi H.cloning site of pGL4 to drive expression of the luciferase reporter (Fig. S1). pRL-SV40 (catalog number E2231; Promega), a Renilla luciferase reporter plasmid, was used as the cotransfected internal control to

(238) The E3 ubiquitin ligase Itch is required for B-cell developmentScientific reportsJanuary 23, 2019Liu X, Zhang Y, Wei Y, Wang Z, Zhu G, Fang Y, Zhai B, Xu R, Han G, Chen G, et al.or pEZX-PG04.1/Itch promoter, and 0.05 μg Renilla luciferase reporter vector pRL-SV-40 vector (cat# E2231, Promega Corp.) were co-transduced into 4 × 105 RAW264.7 or 293T cells in 12-well plate by using 6 μL

(239) Constant Degradation of the Androgen Receptor by MDM2 Conserves Prostate Cancer Stem Cell IntegrityCancer Res.January 9, 2019Premkumar Vummidi Giridhar, Karin Williams, Andrew P. VonHandorf, Paul L. Deford, Susan Kasperwere transfected with the ARR2PB-luc reporter (20) and Renilla luciferase vectors (Promega, cat.#: E2231) and either treated with increasing concentrations of MG132 (to induce endogenous AR) or co-transfected

(240) GATA Binding Protein 3 Boosts Extracellular ATP Hydrolysis and Inhibits Metastasis of Breast Cancer by Up-regulating Ectonucleoside Triphosphate Diphosphohydrolase 3International journal of biological sciencesJanuary 1, 2019Li M, Qi Y, Chen M, Wang Z, Zeng, Xiao Y, Li S, Lin H, Wei X, Zhang G.GGCTACCGTGTTTCAGT. To standardize transfection efficiency, a pRL-SV40 vector (Promega Madison, WI, USA; E2231) was used as the control vector and transfected into cells at the same time. We used a ONE_Glo EX Luciferase Assay System

Be the First to Write a Review!

pRL-SV40 Vector

pRL-SV40 Vector from Promega

Description

Specifications/Features

Promega

Citations (323)

Reviews

pRL-SV40 Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map