psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(141) Regulation of Oncogenic Targets by Tumor-Suppressive miR-150-3p in Lung Squamous Cell CarcinomaBiomedicinesDecember 11, 2021Mizuno K, Tanigawa K, Misono S, Suetsugu T, Sanada H, Uchida A, Kawano M, Machida K, Asai S, Moriya S, et al.Construction and Dual-Luciferase Reporter Assays We prepared psiCHECK-2 plasmid vectors (catalog no.: C8021, Promega, Madison, WI, USA) which have a wild-type or a deletion-type of the miR-150-3p-binding site

(142) miRNA-214-5p inhibits prostate cancer cell proliferation by targeting SOX4World journal of surgical oncologyDecember 4, 2021Xu G, Meng Y, Wang L, Dong B, Peng F, Liu S, Li S, Liu T.from Takara Bio (Dalian) Co., Ltd.. Psicheck-2 and Dual-Luciferase Reporter Assay System (Catalog No.: C8021; E1910) were purchased from Promega. Trizol (Catalog No.: 15596018) was purchased from Thermo Fisher.

(143) LncRNA SFTA1P mediates positive feedback regulation of the Hippo-YAP/TAZ signaling pathway in non-small cell lung cancerCell Death DiscoveryDecember 1, 2021Bowen Zhu et al.Sal I, and subcloned into the 3’ to the Renilla gene within the modified psicheck-2 reporter plasmid (C8021; Promega), in which the original sequence between Pvu I and Not I sites (CGATCGCTCGAGCCCGGGAATTCGTTTAAACCTAGAGCGGCCGC)

(144) Identification of miR-199-5p and miR-199-3p Target Genes: Paxillin Facilities Cancer Cell Aggressiveness in Head and Neck Squamous Cell CarcinomaGenes (Basel)November 27, 2021Nozomi Tanaka et al.miRNA-binding sequence of interest in its 3′ untranslated region (UTR) was inserted into the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). The plasmid vectors were then transfected into cells using Lipofectamine

(145) hsa_circ_0013401 Accelerates the Growth and Metastasis and Prevents Apoptosis and Autophagy of Neuroblastoma Cells by Sponging miR-195 to Release PAK2Oxidative Medicine and Cellular LongevityNovember 22, 2021Shibo Zhu, Xiangliang Tang, Xiaofeng Gao, Jingqi Zhang, Yanhong Cui, Dian Li, Wei Jiacirc_0013401, including the putative miR-195 binding sites and psiCheck-2 vector (Promega, cat. no. C8021). Next, SH-SY5Y or SK-N-BE cells were added to the wells of 6-well plates (1 × 104 cells/well) and incubated

(146) Toxicity after AAV delivery of RNAi expression constructs into nonhuman primate brainNature MedicineNovember 1, 2021Megan S. Keiser et al.activity of noncoding stuffer sequence were generated using the psiCheck2 vector (Promega, catalog no. C8021). Stuffer sequence and ITR components were digested from proviral plasmids using appropriate enzymes,

(147) A mouse-specific retrotransposon drives a conserved Cdk2ap1 isoform essential for developmentCellOctober 28, 2021Modzelewski AJ, Shao W, Chen J, Lee A, Qi X, Noon M, Tjokro K, Sales G, Biton A, Anand A, et al.constructed luciferase reporters for translational assay using psiCheck2 luciferase reporter vector (Promega, C8021). The 5’UTRs of mouse canonical Cdk2ap1 and Cdk2ap1ΔΝ isoforms were cloned immediately upstream of the

(148) Myogenin controls via AKAP6 non-centrosomal microtubule-organizing center formation at the nuclear envelopeeLifeOctober 4, 2021Becker R, Vergarajauregui S, Billing F, Sharkova M, Lippolis E, Mamchaoui K, Ferrazzi F, Engel FB.polyclonal),BioLegend,"Cat# PRB-432C, RRID:AB_291635",IF (1:1000) Recombinant DNA reagent,psiCHECK-2 vector,Promega,Cat# C8021; GenBank Accession Number AY535007, Recombinant DNA reagent,peGPF-N1,Clontech,Cat# 6085-1; GenBank

(149) The long non-coding RNA HOTAIRM1 promotes tumor aggressiveness and radiotherapy resistance in glioblastomaCell Death & DiseaseOctober 1, 2021Ulvi Ahmadov et al.predicted miR-17-5p binding site within the 3’UTR of TGM2, was subcloned into psiCHECK-2 vector (Promega, # C8021). The miR-17-5p binding site 5’-gtcctaagCACTTTataaa-3’ was mutated to 5’- gtcctaagAAAAAAataaa-3’. The

(150) Mechanosensitive miR-100 coordinates TGFβ and Wnt signaling in osteocytes during fluid shear stressFASEB journal : official publication of the Federation of American Societies for Experimental BiologyOctober 1, 2021Dole NS, Yoon J, Monteiro DA, Yang J, Mazur CM, Kaya S, Belair CD, Alliston T.extension step at 72°C for 5 min. The amplification products were cloned into the psiCHECK2 vector (C8021, Promega) multiple cloning site using NotI and XhoI restriction sites. The constructed 3′ UTR luciferase

(151) Early Life Irradiation-Induced Hypoplasia and Impairment of Neurogenesis in the Dentate Gyrus and Adult Depression Are Mediated by MicroRNA- 34a-5p/T-Cell Intracytoplasmic Antigen-1 PathwayCellsSeptember 18, 2021Wang H, Ma Z, Shen H, Wu Z, Liu L, Ren B, Wong P, Sethi G, Tang F.directionally cloned into the PmeI and XhoI unique restriction enzyme sites of psiCHECK-2 plasmid (C8021, Promega Corporation, Madison, WI, USA), which are downstream of the Renilla luciferase gene. Transfection efficiency

(152) Impact of Oncogenic Targets by Tumor-Suppressive miR-139-5p and miR-139-3p Regulation in Head and Neck Squamous Cell CarcinomaInternational Journal of Molecular SciencesSeptember 14, 2021Ayaka Koma et al.Regulation of Target Genes by miR-139-3p Using Dual Luciferase Reporter Assays The psiCHECK-2 vector (C8021; Promega, Madison, WI, USA) was inserted into the synthesized DNA with or without the miR-139-3p binding

(153) Human-Specific Regulation of Neurotrophic Factors MANF and CDNF by microRNAsInternational journal of molecular sciencesSeptember 7, 2021Konovalova J, Gerasymchuk D, Arroyo SN, Kluske S, Mastroianni F, Pereyra AV, Domanskyi A.MA, USA) restriction enzymes and cloned downstream of Renilla luciferase gene in psiCHECK™-2 vector (C8021, Promega, Madison, WI, USA), linearized with the same restriction enzymes. Obtained vectors psiCHECK-hMANF-3′UTR

(154) Defining the RBPome of primary T helper cells to elucidate higher-order Roquin-mediated mRNA regulationNature communicationsSeptember 1, 2021Hoefig KP, Reim A, Gallus C, Wong EH, Behrens G, Conrad C, Xu M, Kifinger L, Ito-Kureha T, Defourny KAY, et al.of total constructs. Each transfection consisted of 75 ng of luciferase reporter plasmid psiCHECK2 (C8021, Promega) or luciferase-5boxB plasmid psiCHECK2 -5boxB, 225 ng of pDEST12.2-λN fused constructs. After

(155) METTL1-mediated m⁷G modification of Arg-TCT tRNA drives oncogenic transformationMolecular cellAugust 19, 2021Orellana EA, Liu Q, Yankova E, Pirouz M, De Braekeleer E, Zhang W, Lim J, Aspris D, Sendinc E, Garyfallos DA, et al.79050 pET30a-AlkB-D135S,Addgene,Cat# 79051 pET-Duet-1,EMD Biosciences,Cat# 71146 psiCheck-2,Promega,Cat# C8021 pBABE-neo,Addgene,Cat# 1767 pLKO.1 puro,Addgene,Cat# 8453 pBABE-neo-WDR4,This manuscript,N/A pLKO.1-puro-ΔU6,This

(156) Castration-Induced Downregulation of SPARC in Stromal Cells Drives Neuroendocrine Differentiation of Prostate CancerCancer ResearchAugust 15, 2021Claudia Enriquez, Valeria Cancila, Renata Ferri, Roberta Sulsenti, Irene Fischetti, Matteo Milani, Paola Ostano, Ilaria Gregnanin, Maurizia Mello-Grand, Enrico Berrino, et al.in a pUC57 vector (Genscript Biotech), and then cloned in a psiCHECK-2 vector (Promega, catalog no. C8021), downstream of Firefly and Renilla luciferase genes, inserted as reporter (the vector was named psiCHECK-SPARC-3′UTR).

(157) Alternative 3' UTRs play a widespread role in translation-independent mRNA association with the endoplasmic reticulumCell reportsJuly 20, 2021Cheng LC, Zheng D, Zhang Q, Guvenek A, Cheng H, Tian B.C2C12 cells,ATCC,CRL-1658 Recombinant DNA,Recombinant DNA,Recombinant DNA Plasmid: psiCHECK2,Promega,C8021 Plasmid: pcDNA3.0,Invitrogen,N/A Plasmid: psiCHECK2-Nmt1(full 3′UTR),This study,N/A Plasmid: pcDNA3-Nmt1(E1-4),This

(158) Exosomal miR-218-5p/miR-363-3p from Endothelial Progenitor Cells Ameliorate Myocardial Infarction by Targeting the p53/JMY Signaling PathwayOxidative Medicine and Cellular LongevityJuly 16, 2021Xiao Ke, Rongfeng Yang, Fang Wu, Xing Wang, Jiawen Liang, Xun Hu, Chengheng Huof JMY, wild-type and mutant sites were constructed and subcloned into psi-Check2 vector (Promega, C8021, Madison, USA). Using Lipofectamine™ 2000 transfection reagent (cat. #52887; Invitrogen, Carlsbad, USA),

(159) Human tRNAs with inosine 34 are essential to efficiently translate eukarya-specific low-complexity proteinsNucleic Acids ResearchJuly 9, 2021Adrian Gabriel Torres et al.reporters SDC3-RLuc and SDC3(G-end)-RLuc plasmids were generated using the backbone vector psiCHECK-2 (C8021, Promega). The psiCHECK-2 RLuc gene was PCR amplified from the vector and the desired portion of SDC3

(160) Castration-Induced Downregulation of SPARC in Stromal Cells Drives Neuroendocrine Differentiation of Prostate CancerCancer ResJune 21, 2021Claudia Enriquez, Valeria Cancila, Renata Ferri, Roberta Sulsenti, Irene Fischetti, Matteo Milani, Paola Ostano, Ilaria Gregnanin, Maurizia Mello-Grand, Enrico Berrino, et al.in a pUC57 vector (Genscript Biotech), and then cloned in a psiCHECK-2 vector (Promega, catalog no. C8021), downstream of Firefly and Renilla luciferase genes, inserted as reporter (the vector was named psiCHECK-SPARC-3′UTR).

Be the First to Write a Review!