psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(201) RNA‐sequence‐based microRNA expression signature in breast cancer: tumor‐suppressive miR‐101‐5p regulates molecular pathogenesisMolecular OncologyFebruary 1, 2020Hiroko Toda et al.and the 3′‐UTR lacking the putative miR‐101‐5p binding sites were cloned into the psiCHECK‐2 vector (C8021; Promega, Madison, WI, USA). Luciferase reporter assays were performed as previously described (Idichi

(202) Environmental enrichment prevents Aβ oligomer-induced synaptic dysfunction through mirna-132 and hdac3 signaling pathwaysNeurobiology of diseaseFebruary 1, 2020Wei Z, Meng X, El Fatimy R, Sun B, Mai D, Zhang J, Arora R, Zeng A, Xu P, Qu S, et al.Luciferase Reporter Assay. Full-length 3′ UTR sequence of mouse Hdac3 was cloned into psiCHECK2 plasmid (Promega, C8021), downstream of renilla luciferase, using XhoI and NotI. Binding site of miR-132-3p was predicted by

(203) Hemorrhagic cerebral small vessel disease caused by a novel mutation in 3′ UTR of collagen type IV alpha 1Neurology GeneticsFebruary 1, 2020Naoko Sakai, Masahiro Uemura, Taisuke Kato, Hiroaki Nozaki, Akihide Koyama, Shouichirou Ando, Hiroyuki Kamei, Motohiro Kato, Osamu Onodera39UTR were subcloned into psiCHECK-2 Dual-Luciferase Reporter plasmid (Promega, Madison, WI; Cat. #C8021). WT was used as a negative control of disruption of the miR-29 binding to the seed sequence, and c*32G>T

(204) miR-221-3p Drives the Shift of M2-Macrophages to a Pro-Inflammatory Function by Suppressing JAK3/STAT3 ActivationFrontiers in ImmunologyJanuary 27, 2020Lilian Quero, André N. Tiaden, Edveena Hanser, Julien Roux, Artur Laski, Jonathan Hall, Diego Kyburzgenerated by cloning commercially synthesized target site inserts (Microsynth) into psiCHECK2 vector (no. C8021, Promega). Sequences of inserted target sites were as follows: JAK3 Site-A 5′-3′: CCTCCACTTCAGCCAGGACTCGAGGAGTTTCCTGTCTTATTTCCAATGGGGACATTCATGTAGCTTTTTTTTTTGCGGCCGCTGAGTCTTCGGACCTCGC JAK3

(205) Epigenetic Silencing of CDR1as Drives IGF2BP3-Mediated Melanoma Invasion and MetastasisCancer cellJanuary 13, 2020Hanniford D, Ulloa-Morales A, Karz A, Berzoti-Coelho MG, Moubarak RS, Sánchez-Sendra B, Kloetgen A, Davalos V, Imig J, Wu P, et al.sensor,This manuscript,N/A psiCHECK2 miR-7 mutant sensor,This manuscript,N/A psiCHECK2 empty,Promega,Cat. # C8021 bdLV-GFP miR-7 WT Sensor-NGFR,This manuscript,N/A bdLV-GFP miR-7 MUT Sensor-NGFR,This manuscript,N/A ,, Software

(206) Human Cytomegalovirus miRNAs Regulate TGF-β to Mediate Myelosuppression while Maintaining Viral Latency in CD34⁺ Hematopoietic Progenitor CellsCell host & microbeJanuary 8, 2020Hancock MH, Crawford LB, Pham AH, Mitchell J, Struthers HM, Yurochko AD, Caposio P, Nelson JA.sequences,, Recombinant DNA,Recombinant DNA,Recombinant DNA pRL SV40-Rluc,Promega,Cat# E2231 pSiCheck2,Promega,PR-C8021 pSIREN-GFP,Clontech,Cat# 632455 SMAD Cignal Reporter Assay,Qiagen,Cat# CCS-017G TGF-β siRNA,ThermoFisher,Cat

(207) Lcn2-derived Circular RNA (hsa_circ_0088732) Inhibits Cell Apoptosis and Promotes EMT in Glioma via the miR-661/RAB3D AxisFrontiers in oncologyJanuary 1, 2020Jin T, Liu M, Liu Y, Li Y, Xu Z, He H, Liu J, Zhang Y, Ke Y.Norcross, GA, USA), and then inserted into a psiCHECK-2 vector (Promega, Madison, WI, USA Cat Number C8021). The primers for hsa_circ_0088732 consisted of a forward primer containing an XhoI site: 5′-CCGCTCGAGGGAGAACCAAGGAGCTGACTTCG-3′,

(208) Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotypeMobile DNADecember 1, 2019Zhuqing Wang et al.promotor that drives the expression of the Renilla luciferase-coding sequence in the psiCHECK-2 plasmid (C8021, Promega). HEK293 cells were transfected with psiCHECK-2 containing the different fragments from the

(209) CircPLEKHM3 acts as a tumor suppressor through regulation of the miR-9/BRCA1/DNAJB6/KLF4/AKT1 axis in ovarian cancerMolecular CancerDecember 1, 2019Lei Zhang et al.disruption buffer. Luciferase report assays The psiCHECK™-2 Vector (Promega, Madison, WI, USA, Cat# C8021), which contains Renilla and firefly luciferase reporter genes, was prepared for luciferase report assays

(210) Role of microRNA-122 in hepatic lipid metabolism of the weanling female rat offspring exposed to prenatal and postnatal caloric restrictionThe Journal of Nutritional BiochemistryNovember 1, 2019Yun Dai, Shubhamoy Ghosh, Bo-Chul Shin, Sherin U. Devaskar(transfection control) and the synthetic Renilla Luciferase (hRluc) gene (reporter) was obtained from Promega (C8021, Madison, WI). A complementary target site for the miR-122 seed sequence (5’-CAAACACCATTGTCACACTCCA-3’)

(211) PRC2 activates interferon-stimulated genes indirectly by repressing miRNAs in glioblastomaPLOS ONESeptember 12, 2019Haridha Shivram, Steven V. Le, Vishwanath R. Iyerleast 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (S1 Table). Mutagenesis was performed using the QuikChange

(212) Aberrantly expressed PLOD1 promotes cancer aggressiveness in bladder cancer: a potential prognostic marker and therapeutic targetMolecular oncologySeptember 1, 2019Yamada Y, Kato M, Arai T, Sanada H, Uchida A, Misono S, Sakamoto S, Komiya A, Ichikawa T, Seki N.between the SgfI and PmeI restriction sites of the 3′‐UTR of the hRluc gene within the psiCHECK‐2 vector (C8021; Promega, Madison, WI, USA). We also generated PLOD1 3′‐UTR sequences containing deletions in the miR‐140‐5p

(213) The RNA hairpin binder TRIM71 modulates alternative splicing by repressing MBNL1Genes & DevelopmentSeptember 1, 2019Thomas Welte, Alex C. Tuck, Panagiotis Papasaikas, Sarah H. Carl, Matyas Flemr, Philip Knuckles, Aneliya Rankova, Marc Bühler, Helge Großhansconstructs were generated by cloning respective 3′ UTRs into the NotI site of psiCHECK-2 (Promega, C8021). For generating pAAVS1 reporter constructs, sequences of unc-54 3′ UTR (pCM5.37; Addgene, 17253; gift

(214) miR-15/16 Restrain Memory T Cell Differentiation, Cell Cycle, and SurvivalCell reportsAugust 20, 2019Gagnon JD, Kageyama R, Shehata HM, Fassett MS, Mar DJ, Wigton EJ, Johansson K, Litterman AJ, Odorizzi P, Simeonov D, et al.mimic,Dharmacon,CN-001000-01-05 miR15b-5p miRIDIAN miRNA mimic,Dharmacon,C-310378-05-0002 Recombinant DNA,, Plasmid: psiCheck-2,Promega,C8021 Plasmid: psiCHECK-2-IL7r,In this study,NA Plasmid: psiCHECK-2-Cd28,In this study,NA Plasmid: siCHECK-2-Adrb2,In

(215) AGO CLIP Reveals an Activated Network for Acute Regulation of Brain Glutamate Homeostasis in Ischemic StrokeCell reportsJuly 23, 2019Kobayashi M, Benakis C, Anderson C, Moore MJ, Poon C, Uekawa K, Dyke JP, Fak JJ, Mele A, Park CY, et al.mm12146 pLenti-III-mir-GFP Control Vector,Applied Biological Materials,Cat# m001 psiCHECK-2 Vector,Promega,Cat# C8021 Software and Algorithms,Software and Algorithms,Software and Algorithms STAR 2.5.2,"Dobin et al.,

(216) miR‑28‑5p suppresses cell proliferation and weakens the progression of polycystic ovary syndrome by targeting prokineticin‑1Molecular Medicine ReportsJuly 1, 2019Lyuhe Meng, Haiyan Yang, Congcong Jin, Song Quanwild‑type (WT) and MUT 3'‑UTRs of PROK1 were then separately ligated into Psi‑CHECK2 plasmids (cat. no. C8021; Promega Corporation). Psi‑CHECK2 plasmids were co‑transfected with miR‑28‑5p mimics or NC into cells

(217) HNRNPA1-mediated 3′ UTR length changes of HN1 contributes to cancer- and senescence-associated phenotypesAging (Albany NY)June 30, 2019Qi Jia, Hongbo Nie, Peng Yu, Baiyun Xie, Chenji Wang, Fu Yang, Gang Wei, Ting NiUTR sequence was amplified from human genomic DNA and cloned into psiCHECK2 vector (Promega, cat. no. C8021) using the XhoI and PmeI restriction enzyme sites located at the 3′ end of the Renilla gene. All construct

(218) Mutant FUS and ELAVL4 (HuD) Aberrant Crosstalk in Amyotrophic Lateral SclerosisCell reportsJune 25, 2019De Santis R, Alfano V, de Turris V, Colantoni A, Santini L, Garone MG, Antonacci G, Peruzzi G, Sudria-Lopez E, Wyler E, et al.RRID: Addgene_65757 Plasmid epB-Puro-TT-RFP,"Rosa et al., 2014",N/A pSI-Check2 vector,Promega,Cat#C8021; RRID: Addgene_106979 Plasmid epB-Puro-TT-RFP-FUS,This paper,N/A Plasmid epB-Puro-TT-RFP-FUS-P525L,This

(219) Downregulation of microRNA‑199a‑5p attenuates hypoxia/reoxygenation‑induced cytotoxicity in cardiomyocytes by targeting the HIF‑1α‑GSK3β‑mPTP axisMolecular medicine reportsJune 1, 2019Liu DW, Zhang YN, Hu HJ, Zhang PQ, Cui W.cat. no. 55704; Celprogen, Inc.) was cloned into a psiCHECK™-2 luciferase reporter vector (cat. no. C8021, Promega) to generate HIF-1α (WT). The mutant (MUT) version of the HIF-1α 3′-UTR lacking complementary

(220) Common Regulatory Pathways Mediate Activity of MicroRNAs Inducing Cardiomyocyte ProliferationCell reportsMay 28, 2019Torrini C, Cubero RJ, Dirkx E, Braga L, Ali H, Prosdocimo G, Gutierrez MI, Collesi C, Licastro D, Zentilin L, et al.pCSII-EF-MCS plasmid,"Gift from Stefano Piccolo, University of Padova",N/A psiCheck2.1 plasmid,Promega,Cat# C8021 3′UTR-Cfl2 plasmid,Biomatik,Clone ID T4545-1 3′UTR-β-TrC plasmid,Genewiz,Clone ID B28633-1/K28633 3′UTR-TAOK1

Be the First to Write a Review!