psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(101) MicroRNA signature of small‐cell lung cancer after treatment failure: impact on oncogenic targets by miR‐30a‐3p controlMolecular OncologyFebruary 1, 2023Kengo Tanigawa, Shunsuke Misono, Keiko Mizuno, Shunichi Asai, Takayuki Suetsugu, Akifumi Uchida, Minami Kawano, Hiromasa Inoue, Naohiko Sekidual‐luciferase reporter assays The following two sequences were cloned into the psiCHECK‐2 vector (C8021; Promega, Madison, WI, USA): the wild‐type sequence of the 3′‐untranslated regions (UTRs) of DONSON

(102) Aberrant promoter hypermethylation of miR-335 and miR-145 is involved in breast cancer PD-L1 overexpressionScientific reportsJanuary 18, 2023Hajibabaei S, Sotoodehnejadnematalahi F, Nafissi N, Zeinali S, Azizi M.sequence (AAGCTTCATAGGGCATAGC) as a negative control were cloned into the psiCHECKTM-2 vector (Promega, C8021) to perform luciferase reporter assays (PCR primers are listed in Table 2). BC cells were transfected

(103) Pharmacological inhibition of Lin28 promotes ketogenesis and restores lipid homeostasis in models of non-alcoholic fatty liver diseaseNature communicationsDecember 26, 2022Lekka E, Kokanovic A, Mosole S, Civenni G, Schmidli S, Laski A, Ghidini A, Iyer P, Berk C, Behera A, et al.target site inserts, synthesized by Microsynth (Balgach, Switzerland), into psiCHECK-2 vector (no. C8021, Promega, Dübendorf). Sequences of inserted target sites were as follows: NCoR1 WT 5’−3’: CTC GAG AGG

(104) circFBXO7/miR-96-5p/MTSS1 axis is an important regulator in the Wnt signaling pathway in ovarian cancerMolecular CancerDecember 1, 2022Mengting Wu et al.circFBXO7 (or the 3′ UTR of MTSS1) was subcloned into the psiCHECK2 vector (Promega, Madison, WI, USA, Cat# C8021). In the mutant vectors, the miR-96-5p binding sites in circFBXO7 or the 3’UTR of MTSS1 were mutated

(105) Follicular fluid-derived exosomal miR-143-3p/miR-155-5p regulate follicular dysplasia by modulating glycolysis in granulosa cells in polycystic ovary syndromeCell Communication and SignalingDecember 1, 2022Jianping Cao, Peng Huo, Kuiqing Cui, Huimei Wei, Junna Cao, Jinyuan Wang, Qingyou Liu, Xiaocan Lei, Shun ZhangmRNA fragment was constructed and inserted downstream of the luciferase reporter gene of psiCheck2 (#C8021, Promega, Madison, USA). When KGN cells reached 50–60% confluence, miRNA mimics (100 nM) or the mimic

(106) The global Protein-RNA interaction map of ESRP1 defines a post-transcriptional program that is essential for epithelial cell functioniScienceOctober 21, 2022Peart NJ, Hwang JY, Quesnel-Vallières M, Sears MJ, Yang Y, Stoilov P, Barash Y, Park JW, Lynch KW, Carstens RP.S6,See Table S6 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, Plasmid: psiCheck2,Promega,C8021 Plasmid: pIS0,Addgene,121718 Plasmid: pIBX-ESRP1 2A + CKLP,"(Yang and Carstens, 2017)",N/A Plasmid:

(107) Characteristics of environmental RNAi in potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Psylloidea: Triozidae)Frontiers in PhysiologyOctober 18, 2022Mosharrof Mondal, Megan Carver, Judith K. BrownNo. A3600) (Data Sheet S2; Supplementary Tables S2–S5). From the psiCHECK-2 vector (Promega, Cat. No. C8021), a 231-nucleotide (nt) region was selected from the firefly luciferase gene sequence available for

(108) Tumor elimination by clustered microRNAs miR-306 and miR-79 via noncanonical activation of JNK signalingeLifeOctober 12, 2022Wang Z, Xia X, Li J, Igaki T.(Cell Signaling Technology, Cat #7074, 1:5000). Dual-luciferase reporter assay The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay. RNF146 3′UTR or its mutant was cloned

(109) Molecular Pathogenesis of Colorectal Cancer: Impact of Oncogenic Targets Regulated by Tumor Suppressive miR-139-3pInternational Journal of Molecular SciencesOctober 1, 2022Ryutaro Yasudome, Naohiko Seki, Shunichi Asai, Yusuke Goto, Yoshiaki Kita, Yuto Hozaka, Masumi Wada, Kan Tanabe, Tetsuya Idichi, Shinichiro Mori, et al.sequence, including the seed sequence, of the KRT80 3′-UTR, was inserted into the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). Alternatively, the same KRT80 3′-UTR sequence but with the miR-139-3p binding

(110) MiR-27a downregulates 14-3-3θ, RUNX1, AF4, and MLL-AF4, crucial drivers of blast transformation in t(4;11) leukemia cellsCell biochemistry and functionOctober 1, 2022Fioretti T, Zanobio M, Raia M, Errichiello S, Izzo B, Cattaneo F, Ammendola R, Cevenini A, Esposito G.R—NotI: 5′‐ GCCGGC/GGCCGCATAAGTGCGGTCCAATCTGT‐3′. Amplified fragments were cloned in psiCHECK2™ vector (#C8021; Promega) after digestion with SgF1 #R7103 (Promega) or XhoI #10703770001, and NotI #11014714001 (Roche).

(111) miR ‐486 improves fibrotic activity in myocardial infarction by targeting SRSF3 / p21‐Mediated cardiac myofibroblast senescenceJournal of Cellular and Molecular MedicineOctober 1, 2022Hongyi Chen, Luocheng Lv, Ruoxu Liang, Weimin Guo, Zhaofu Liao, Yilin Chen, Kuikui Zhu, Ruijin Huang, Hui Zhao, Qin Pu, et al.sequences from the 3' untranslated regions (3'UTRs) of the SRSF3 mRNAs into the psiCHECK‐2 vector (cat. No. C8021, Promega). For details, see Appendix. 2.14 RNA interference The synthesized siSRSF3 (5'‐CCCAAGAAGGAGAAGCTTT‐3')

(112) SFPQ promotes RAS-mutant cancer cell growth by modulating 5′-UTR mediated translational control of CK1αNAR CancerSeptember 27, 2022Venetia Jing Tong Kok et al.METHODS Plasmid constructs and cell lines The bipromoter vector psiCHECK™-2 was purchased from Promega (C8021) and the bicistronic vector pR_F was a kind gift from Dr Luísa Romão (16). The psiCHECK™-2 vector carries

(113) Chemical optimization of siRNA for safe and efficient silencing of placental sFLT1Molecular therapy. Nucleic acidsSeptember 13, 2022Davis SM, Hariharan VN, Lo A, Turanov AA, Echeverria D, Sousa J, McHugh N, Biscans A, Alterman JF, Karumanchi SA, et al.regions of sFLT1-i13 and/or sFLT1-e15a target mRNAs (see Table S2) were cloned into psiCheck-2 vectors (C8021, Promega, Madison, WI) according to the manufacturer’s protocol. HeLa cells were plated (36 or 66 cells/10-cm

(114) E2F1/CKS2/PTEN signaling axis regulates malignant phenotypes in pediatric retinoblastomaCell death & diseaseSeptember 12, 2022Chen M, Zhao Z, Wu L, Huang J, Yu P, Qian J, Ni T, Zhao C.TFs could bind to the promoter region of CKS2, a dual luciferase vector psiCHECK2 (Promega, cat. no. C8021) with CKS2’s wild-type (WT) or mutated promotors (Mut) was constructed. The promotor (WT or Mut) of

(115) SQSTM1/p62 promotes miR-198 loading into extracellular vesicles and its autophagy-related secretionHuman CellSeptember 1, 2022Xiaojie Yu, Hannah Eischeid-Scholz, Lydia Meder, Vangelis Kondylis, Reinhard Büttner, Margarete Odenthalaligned by CLC sequence viewer v6.0. Dual reporter luciferase assays The psiCheck™-2 plasmid (Promega, #C8021) harbors two expression cassette, driving expression of the Renilla and Firefly luciferase enzymes.

(116) Single-cell transcriptome and translatome dual-omics reveals potential mechanisms of human oocyte maturationNature communicationsAugust 30, 2022Hu W, Zeng H, Shi Y, Zhou C, Huang J, Jia L, Xu S, Feng X, Zeng Y, Xiong T, et al.previously described39. Briefly, the 3′-UTR of human OOSP2 was cloned into the psiCHECK2 vector (Promega, C8021) according to sequences downloaded from the NCBI website. The primers used are shown in Supplementary

(117) The silencing of ets-4 mRNA relies on the functional cooperation between REGE-1/Regnase-1 and RLE-1/Roquin-1Nucleic acids researchAugust 12, 2022Sobańska D, Komur AA, Chabowska-Kita A, Gumna J, Kumari P, Pachulska-Wieczorek K, Ciosk R.6. Dual-luciferase assay The 3′-UTRs were cloned into psiCheck-2 plasmid (Promega, USA, Cat. No. C8021) using the XhoI and NotI sites. The short fragment of the ets-4 3′-UTR (F1S) was inserted into the AscI

(118) microRNA-455-5p alleviates neuroinflammation in cerebral ischemia/reperfusion injuryNeural regeneration researchAugust 1, 2022Zhang JS, Hou PP, Shao S, Manaenko A, Xiao ZP, Chen Y, Zhao B, Jia F, Zhang XH, Mei QY, et al.and the respective mutant controls into the luciferase reporter plasmid PGL3 miReport vector (Cat# C8021, Promega, Madison, WI, USA). Human embryonic kidney 293T (HEK293T) cells (Cat# 12022001-1VL, RRID: CVCL_0063,

(119) Upregulation of β-catenin due to loss of miR-139 contributes to motor neuron death in amyotrophic lateral sclerosisStem Cell ReportsJuly 12, 2022Sophie Hawkins et al.resultant sequence was cloned downstream of the Renilla luciferase gene in the PSICheck2 vector (Promega C8021). To mutate the miR-139 binding site, we deleted positions 2, 4, and 6 of the predicted miRNA binding

(120) Identification of Antitumor miR-30e-5p Controlled Genes; Diagnostic and Prognostic Biomarkers for Head and Neck Squamous Cell CarcinomaGenesJuly 9, 2022Minemura C, Asai S, Koma A, Kikkawa N, Kato M, Kasamatsu A, Uzawa K, Hanazawa T, Seki N.sequence of FOXD1 within the 3′-untranslated region (3′-UTR), was inserted into the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). Alternatively, a deletion type that was missing the miR-30e-5p target site

Be the First to Write a Review!