psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(101) LncRNA FALEC increases the proliferation, migration and drug resistance of cholangiocarcinoma through competitive regulation of miR-20a-5p/SHOC2 axisAging (Albany NY)May 15, 2023Haiming Du, Senlin Hou, Lichao Zhang, Chao Liu, Tingting Yu, Wei Zhangcells. Dual-luciferase reporter assay We obtained the cDNA clone of FALEC from NCBI (Gene ID: 100874054). The plasmid (C8021, psiCHECK™-2 Vectors, Promega) containing the full length wild-type (WT) or mutant (Mut) FALEC miRNA

(102) miR-34c-3p Regulates Protein Kinase A Activity Independent of cAMP by Dicing prkar2b Transcripts in Theileria annulata-Infected LeukocytesmSphereApril 20, 2023Malak Haidar, Shahin Tajeri, Laurence Momeux, Tobias Mourier, Fathia Ben-Rached, Sara Mfarrej, Zineb Rchiad, Arnab Pain, Gordon Langsleythe identified canonical miR-34c-3p seed sequence, was subcloned into the psiCHECK-2 vector (Promega; C8021) and transfected into attenuated macrophages, together with the miR-34c-3p mimic, and the Renilla luciferase

(103) RNAi-mediated rheostat for dynamic control of AAV-delivered transgenesNature communicationsApril 8, 2023Subramanian M, McIninch J, Zlatev I, Schlegel MK, Kaittanis C, Nguyen T, Agarwal S, Racie T, Alvarado MA, Wassarman K, et al.containing a fully complementary (23-mer) or partial siRNA target sites into the psiCHECK2 vector (Promega C8021) between Xho1 and Not1 restriction sites. The on-target reporter plasmids contain a single site with

(104) A diagnostic circulating miRNA signature as orchestrator of cell invasion via TKS4/TKS5/EFHD2 modulation in human gliomasJournal of experimental & clinical cancer research : CRMarch 17, 2023Díaz Méndez AB, Sacconi A, Tremante E, Lulli V, Caprara V, Rosanò L, Goeman F, Carosi M, Di Giuliani M, Vari G, et al.and their mutants were cloned into pGL3 Control vector (#E1741, Promega) or into psiCHECK2 vector (#C8021, Promega) downstream of the luciferase gene. Human HEK-293 T (RRID: CVCL_4U22) cells were transiently

(105) Divalent siRNAs are bioavailable in the lung and efficiently block SARS-CoV-2 infectionProceedings of the National Academy of Sciences of the United States of AmericaMarch 14, 2023Hariharan VN, Shin M, Chang CW, O'Reilly D, Biscans A, Yamada K, Guo Z, Somasundaran M, Tang Q, Monopoli K, et al.to 20-nucleotide long, unique regions of target mRNAs were cloned into a psiCHECK-2 vector (Promega; C8021) according to the manufacturer′s protocol. HeLa cells were transfected with reporter plasmid using Lipofectamine

(106) Cancer stem cell-like cells-derived exosomal lncRNA CDKN2B-AS1 promotes biological characteristics in thyroid cancer via miR-122-5p/P4HA1 axisRegenerative TherapyMarch 1, 2023Qinghua Wu, Yonggang He, Xin Liu, Fangxiu Luo, Yimei Jiang, Ming Xiang, Ren Zhaomutant (MUT) reporter plasmid (CDKN2B-AS1-MUT or P4HA1-MUT) were constructed using psiCHECK-2 vector (C8021, Promega, USA). The sequences of miR-122-5p mimic (M) (miR10000421-1-5) and mimic control (MC) (miR1N0000001-1-5)

(107) miR579-3p is an inhibitory modulator of neointimal hyperplasia and transcription factors c-MYB and KLF4Cell death discoveryFebruary 22, 2023Xie X, Shirasu T, Li J, Guo LW, Kent KC.and PDGF-BB (520-BB) were from R&D Systems. Cell Titer-Glo 2.0 Assay kit (G9242), psiCHECK2 vector (C8021), and Dual-Luciferase Reporter Assay System (E1910) were from Promega. The following products were from

(108) MicroRNA signature of small‐cell lung cancer after treatment failure: impact on oncogenic targets by miR‐30a‐3p controlMolecular OncologyFebruary 1, 2023Kengo Tanigawa, Shunsuke Misono, Keiko Mizuno, Shunichi Asai, Takayuki Suetsugu, Akifumi Uchida, Minami Kawano, Hiromasa Inoue, Naohiko Sekidual‐luciferase reporter assays The following two sequences were cloned into the psiCHECK‐2 vector (C8021; Promega, Madison, WI, USA): the wild‐type sequence of the 3′‐untranslated regions (UTRs) of DONSON

(109) Aberrant promoter hypermethylation of miR-335 and miR-145 is involved in breast cancer PD-L1 overexpressionScientific reportsJanuary 18, 2023Hajibabaei S, Sotoodehnejadnematalahi F, Nafissi N, Zeinali S, Azizi M.sequence (AAGCTTCATAGGGCATAGC) as a negative control were cloned into the psiCHECKTM-2 vector (Promega, C8021) to perform luciferase reporter assays (PCR primers are listed in Table 2). BC cells were transfected

(110) Pharmacological inhibition of Lin28 promotes ketogenesis and restores lipid homeostasis in models of non-alcoholic fatty liver diseaseNature communicationsDecember 26, 2022Lekka E, Kokanovic A, Mosole S, Civenni G, Schmidli S, Laski A, Ghidini A, Iyer P, Berk C, Behera A, et al.target site inserts, synthesized by Microsynth (Balgach, Switzerland), into psiCHECK-2 vector (no. C8021, Promega, Dübendorf). Sequences of inserted target sites were as follows: NCoR1 WT 5’−3’: CTC GAG AGG

(111) circFBXO7/miR-96-5p/MTSS1 axis is an important regulator in the Wnt signaling pathway in ovarian cancerMolecular CancerDecember 1, 2022Mengting Wu et al.circFBXO7 (or the 3′ UTR of MTSS1) was subcloned into the psiCHECK2 vector (Promega, Madison, WI, USA, Cat# C8021). In the mutant vectors, the miR-96-5p binding sites in circFBXO7 or the 3’UTR of MTSS1 were mutated

(112) Follicular fluid-derived exosomal miR-143-3p/miR-155-5p regulate follicular dysplasia by modulating glycolysis in granulosa cells in polycystic ovary syndromeCell Communication and SignalingDecember 1, 2022Jianping Cao, Peng Huo, Kuiqing Cui, Huimei Wei, Junna Cao, Jinyuan Wang, Qingyou Liu, Xiaocan Lei, Shun ZhangmRNA fragment was constructed and inserted downstream of the luciferase reporter gene of psiCheck2 (#C8021, Promega, Madison, USA). When KGN cells reached 50–60% confluence, miRNA mimics (100 nM) or the mimic

(113) The global Protein-RNA interaction map of ESRP1 defines a post-transcriptional program that is essential for epithelial cell functioniScienceOctober 21, 2022Peart NJ, Hwang JY, Quesnel-Vallières M, Sears MJ, Yang Y, Stoilov P, Barash Y, Park JW, Lynch KW, Carstens RP.S6,See Table S6 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, Plasmid: psiCheck2,Promega,C8021 Plasmid: pIS0,Addgene,121718 Plasmid: pIBX-ESRP1 2A + CKLP,"(Yang and Carstens, 2017)",N/A Plasmid:

(114) Characteristics of environmental RNAi in potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Psylloidea: Triozidae)Frontiers in PhysiologyOctober 18, 2022Mosharrof Mondal, Megan Carver, Judith K. BrownNo. A3600) (Data Sheet S2; Supplementary Tables S2–S5). From the psiCHECK-2 vector (Promega, Cat. No. C8021), a 231-nucleotide (nt) region was selected from the firefly luciferase gene sequence available for

(115) Tumor elimination by clustered microRNAs miR-306 and miR-79 via noncanonical activation of JNK signalingeLifeOctober 12, 2022Wang Z, Xia X, Li J, Igaki T.(Cell Signaling Technology, Cat #7074, 1:5000). Dual-luciferase reporter assay The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay. RNF146 3′UTR or its mutant was cloned

(116) Molecular Pathogenesis of Colorectal Cancer: Impact of Oncogenic Targets Regulated by Tumor Suppressive miR-139-3pInternational Journal of Molecular SciencesOctober 1, 2022Ryutaro Yasudome, Naohiko Seki, Shunichi Asai, Yusuke Goto, Yoshiaki Kita, Yuto Hozaka, Masumi Wada, Kan Tanabe, Tetsuya Idichi, Shinichiro Mori, et al.sequence, including the seed sequence, of the KRT80 3′-UTR, was inserted into the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). Alternatively, the same KRT80 3′-UTR sequence but with the miR-139-3p binding

(117) MiR-27a downregulates 14-3-3θ, RUNX1, AF4, and MLL-AF4, crucial drivers of blast transformation in t(4;11) leukemia cellsCell biochemistry and functionOctober 1, 2022Fioretti T, Zanobio M, Raia M, Errichiello S, Izzo B, Cattaneo F, Ammendola R, Cevenini A, Esposito G.R—NotI: 5′‐ GCCGGC/GGCCGCATAAGTGCGGTCCAATCTGT‐3′. Amplified fragments were cloned in psiCHECK2™ vector (#C8021; Promega) after digestion with SgF1 #R7103 (Promega) or XhoI #10703770001, and NotI #11014714001 (Roche).

(118) miR ‐486 improves fibrotic activity in myocardial infarction by targeting SRSF3 / p21‐Mediated cardiac myofibroblast senescenceJournal of Cellular and Molecular MedicineOctober 1, 2022Hongyi Chen, Luocheng Lv, Ruoxu Liang, Weimin Guo, Zhaofu Liao, Yilin Chen, Kuikui Zhu, Ruijin Huang, Hui Zhao, Qin Pu, et al.sequences from the 3' untranslated regions (3'UTRs) of the SRSF3 mRNAs into the psiCHECK‐2 vector (cat. No. C8021, Promega). For details, see Appendix. 2.14 RNA interference The synthesized siSRSF3 (5'‐CCCAAGAAGGAGAAGCTTT‐3')

(119) SFPQ promotes RAS-mutant cancer cell growth by modulating 5′-UTR mediated translational control of CK1αNAR CancerSeptember 27, 2022Venetia Jing Tong Kok et al.METHODS Plasmid constructs and cell lines The bipromoter vector psiCHECK™-2 was purchased from Promega (C8021) and the bicistronic vector pR_F was a kind gift from Dr Luísa Romão (16). The psiCHECK™-2 vector carries

(120) Chemical optimization of siRNA for safe and efficient silencing of placental sFLT1Molecular therapy. Nucleic acidsSeptember 13, 2022Davis SM, Hariharan VN, Lo A, Turanov AA, Echeverria D, Sousa J, McHugh N, Biscans A, Alterman JF, Karumanchi SA, et al.regions of sFLT1-i13 and/or sFLT1-e15a target mRNAs (see Table S2) were cloned into psiCheck-2 vectors (C8021, Promega, Madison, WI) according to the manufacturer’s protocol. HeLa cells were plated (36 or 66 cells/10-cm

Be the First to Write a Review!