Reverse Transcription System from Promega

Product Specs
ItemReverse Transcription System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3500
Quantity100 reactions
PrimersOligo(dT)₁₅ Primer and Random Primers

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(121) Post-treatment with propofol inhibits inflammatory response in LPS-induced alveolar type II epithelial cellsExperimental and therapeutic medicineApril 1, 2022Yang X, Ma L.AMV reverse transcriptase and 1 µl Oligo primer, which were components of a Reverse Transcription system kit (cat. no. A3500; Promega Corporation), according to the manufacturer's protocol, incubating at 42˚C for 15 min, 95˚C

(122) Chlorine Dioxide Inhibits African Swine Fever Virus by Blocking Viral Attachment and Destroying Viral Nucleic Acids and ProteinsFrontiers in Veterinary ScienceMarch 17, 2022Ruiping Wei, Xiaoying Wang, Yongchang Cao, Lang Gong, Xiaohong Liu, Guihong Zhang, Chunhe Guo(Magen, China) according to the manufacturer's instructions. Briefly, Reverse Transcription System (A3500, Promega, USA) was used for reverse transcription in 20 μL reaction volume. The reverse-transcription

(123) Suhuang Antitussive Capsule Ameliorates Corticosteroid Insensitivity in Cough Variant Asthma Guinea Pigs by Inhibiting p38 MAPK Signal PathwayEvidence-Based Complementary and Alternative MedicineMarch 17, 2022Tianyi Lyu, Demin Li, Haojun Zhang, Siyi Chen, Daowen Yangaccording to manufacturer's protocol for extraction. 1μg RNA was reverse-transcribed to cDNA in 20 μl using A3500 Reverse Transcription System (Promega, United States). Quantitative real-time PCR was performed using

(124) Targeting non-canonical pathways as a strategy to modulate the sodium iodide symporterCell chemical biologyMarch 17, 2022Read ML, Brookes K, Thornton CEM, Fletcher A, Nieto HR, Alshahrani M, Khan R, Borges de Souza P, Zha L, Webster JRM, et al.,ThermoFisher Scientific,Cat# 13778075 RNeasy Micro Kit,Qiagen,Cat# 74004 Reverse Transcription System,Promega,Cat# A3500 EndoFree Plasmid Maxi Kit,Qiagen,Cat# 12362 TaqMan® Gene Expression Master Mix,Applied Biosystems,Cat#

(125) Optimization in Chemical Modification of Single-Stranded siRNA Encapsulated by Neutral Cytidinyl/Cationic LipidsFrontiers in ChemistryMarch 7, 2022Zheng Li, Xixian Wang, Xinyang Zhou, Jie Wang, Zhu Guan, Zhenjun Yangextract the total RNA, stored at -80 °C. The RNA was reversed to cDNA by Reverse Transcription kit (A3500, Promega, United States), stored at -20 °C. The cDNA was then mixed with GoTaq® qPCR Master Mix (A6002,

(126) Targeting Induced Local Lesions in the Wheat DEMETER and DRE2 Genes, Responsible for Transcriptional Derepression of Wheat Gluten Proteins in the Developing EndospermFrontiers in NutritionMarch 3, 2022Nuan Wen et al.using a reverse transcription system with random oligos following the manufacturer's instructions (A3500, Promega). The qRT-PCR analysis was performed using the LightCycler DNA Master SYBR Green I system (12158817001,

(127) Ptf1a Promoter-Driven Cre Expression During Spermatogenesis Causes Germline RecombinationPancreasFebruary 23, 2022Jiale Wang, Oliver Wang, Yan Bi, Ying Wang, Howard Crawford, Baoan JiCalif) and further purified with the RNeasy Plus Mini Kit (Qiagen). Reverse Transcription System (#A3500, Promega, Madison, Wis.) was used to transcribe RNA into cDNA using 2 μg of total RNA. Polymerase chain reaction

(128) ITIH5-Derived Polypeptides Covering the VIT Domain Suppress the Growth of Human Cancer Cells In VitroCancers (Basel)January 19, 2022Michael Rose et al.(Thermo Fisher Scientific), and 1 µg of RNA was used for cDNA reverse transcription by the Promega Kit A3500 according to the manufacturer’s instructions (Promega, Mannheim, Germany). 4.5. Real-Time qPCR ITIH5

(129) MiR-423-5p prevents MALAT1-mediated proliferation and metastasis in prostate cancerJournal of Experimental & Clinical Cancer ResearchJanuary 11, 2022Carmela Ferri, Anna Di Biase, Marco Bocchetti, Silvia Zappavigna, Sarah Wagner, Pauline Le Vu, Amalia Luce, Alessia Maria Cossu, Jayakumar Vadakekolathu, Amanda Miles, et al.LOX, E-cadherin, N-cadherin, Fibronectin-1 and ZEB-1 the PROMEGA Reverse Transcription System (Ref. A3500) was used to obtain cDNA. RT-qPCR was performed using iTaq Universal SYBR Green Supermix (BioRad Cat.No.

(130) Water Treadmill Training Ameliorates Neurite Outgrowth Inhibition Associated with NGR/RhoA/ROCK by Inhibiting Astrocyte Activation following Spinal Cord InjuryOxidative medicine and cellular longevityJanuary 1, 2022Ying X, Yu X, Zhu J, Li X, Zheng Y, Xie Q, Wu Q, Li S, Yue J, Zhou Y, et al.5′ACGCTGCAGTCAGAGGAGTG3′ (forward), 5′CTGCCGCCGGTACTCAGTTA 3′ (reverse) for NF200. High Capacity RNA-to-cDNA Master Mix (A3500, Promega) was applied to reverse transcribed the one microgram of total RNA. Real-time amplification

(131) Differentiation and on axon-guidance chip culture of human pluripotent stem cell-derived peripheral cholinergic neurons for airway neurobiology studiesFrontiers in pharmacologyJanuary 1, 2022Goldsteen PA, Sabogal Guaqueta AM, Mulder PPMFA, Bos IST, Eggens M, Van der Koog L, Soeiro JT, Halayko AJ, Mathwig K, Kistemaker LEM, et al.for RT-qPCR or RNA sequencing. For RT-qPCR, cDNA was synthesized using Reverse Transcription System (A3500, Promega, Leiden, Netherlands) according to the manufacturer’s protocol. The qRT-PCR reactions were

(132) Network Pharmacology Analysis and Experimental Validation to Investigate the Mechanism of Total Flavonoids of Rhizoma Drynariae in Treating Rheumatoid ArthritisDrug design, development and therapyJanuary 1, 2022Chen GY, Luo J, Liu Y, Yu XB, Liu XY, Tao QW.CellTiter 96® AQueous One Solution Cell Proliferation Assay (G358A, Promega, USA), Reverse Transcription System (A3500, Promega, USA), HiPure Total RNA Mini Kit (R4111-02, Magen, China), 10% PAGE Gel Fast Preparation Kit

(133) Ptf1a Promoter-driven Cre Expression During Spermatogenesis Causes Germline RecombinationPancreasJanuary 1, 2022Jiale Wang, Oliver Wang, Yan Bi, Ying Wang, Howard Crawford, Baoan JiCalif) and further purified with the RNeasy Plus Mini Kit (Qiagen). Reverse Transcription System (#A3500, Promega, Madison, Wis.) was used to transcribe RNA into cDNA using 2 μg of total RNA. Polymerase chain reaction

(134) Role of follistatin-like 1 levels and functions in calcific aortic stenosisFrontiers in cardiovascular medicineJanuary 1, 2022Zhang Q, Ye J, Yang G, Yang L, Chen Z, Yang K, Sun JT, Liu Y.Thermo Fisher Scientific (USA) were used for immunofluorescence staining. The Reverse Transcription System (Cat# A3500, Promega, USA) and SYBR® Premix Ex Taq™ II (Tli RNaseH Plus, Cat# RR820A, Takara Bio, Japan) were used

(135) Fadrozole-mediated sex reversal in the embryonic chicken gonad involves a PAX2 positive undifferentiated supporting cell stateFrontiers in cell and developmental biologyJanuary 1, 2022Estermann MA, Smith CA.and 1 μg of total RNA was reversed transcribed into cDNA using Promega Reverse Transcription System (A3500). qRT-PCR was performed using the QuantiNova SYBR® Green PCR Kit. PAX2 expression levels were quantified

(136) Network Pharmacology-Based Strategy to Investigate the Mechanisms of Cibotium barometz in Treating OsteoarthritisEvidence-based complementary and alternative medicine : eCAMJanuary 1, 2022Chen GY, Wang YF, Yu XB, Liu XY, Chen JQ, Luo J, Tao QW.Oligo (dT)15 primer and nuclease-free water to a final volume of 20°ul were used to construct a transcription system (A3500, Promega, USA). The mixture was heated at 42°C for 15 min, then heated at 95°C for 5 min and cooled

(137) Enhancer RNA Expression in Response to Glucocorticoid Treatment in Murine MacrophagesCellsDecember 23, 2021Franziska Greulich, Kirsten Adele Bielefeld, Ronny Scheundel, Aikaterini Mechtidou, Benjamin Strickland, Nina Henriette Uhlenhautand 500 ng RNA were reverse transcribed with the Reverse Transcription System from Promega (Cat. No.: A3500) according to the manufacturer’s manual. Importantly, DNA contaminations were removed via DNaseI treatment.

(138) Regulation of rose petal dehydration tolerance and senescence by RhNAP transcription factor via the modulation of cytokinin catabolismMolecular HorticultureDecember 1, 2021Jing Zou, Peitao Lü, Liwei Jiang, Kun Liu, Tao Zhang, Jin Chen, Yi Yao, Yusen Cui, Junping Gao, Changqing Zhangto synthesize cDNA according to the manufacturer’s instructions using a reverse transcription system A3500 kit (Promega), with a 20 μl reaction volume. A 2 μl aliquot of cDNA was used as the template in a 20

(139) Novel insights into the genetically obese (ob/ob) and diabetic (db/db) mice: two sides of the same coinMicrobiomeDecember 1, 2021Francesco Suriano et al.

(140) Role of ASM/Cer/TXNIP signaling module in the NLRP3 inflammasome activationLipids in Health and DiseaseDecember 1, 2021Jianjun Jiang, Yining Shi, Jiyu Cao, Youjin Lu, Gengyun Sun, Jin Yangthe Promega reagent (Promega, Beijing, China) according to the manufacturer’s instructions. Promega-A3500 kit was used for reverse transcription of RNA and quantitation of cDNA. The 2-ΔΔCt method was used to

Be the First to Write a Review!