Reverse Transcription System from Promega

Product Specs
ItemReverse Transcription System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3500
Quantity100 reactions
PrimersOligo(dT)₁₅ Primer and Random Primers

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(81) Tuo-Min-Ding-Chuan Decoction Alleviates Airway Inflammations in the Allergic Asthmatic Mice Model by Regulating TLR4-NLRP3 Pathway-Mediated Pyroptosis: A Network Pharmacology and Experimental Verification StudyDrug Des Devel TherJune 2, 2023Mingsheng Lyu, Jingbo Qin, Shuaiyang Huang, Dongmei Shao, Guirui Huang, Fan Yang, Xuefeng Gong, Shiyu Zhang, Zhijie Zhang, Ji Wang, et al.PAGE gel fast preparation kit [Shanghai Epizyme, R4011-03], Reverse Transcription System [Promega, A3500], qPCR Master Mix [Promega, A6002], radio-immunoprecipitation assay (RIPA) lysis buffer [Beijing Applygen,

(82) Tuo-Min-Ding-Chuan Decoction Alleviates Airway Inflammations in the Allergic Asthmatic Mice Model by Regulating TLR4-NLRP3 Pathway-Mediated Pyroptosis: A Network Pharmacology and Experimental Verification StudyDrug Design, Development and TherapyJune 2, 2023Mingsheng Lyu, Jingbo Qin, Shuaiyang Huang, Dongmei Shao, Guirui Huang, Fan Yang, Xuefeng Gong, Shiyu Zhang, Zhijie Zhang, Ji Wang, et al.PAGE gel fast preparation kit [Shanghai Epizyme, R4011-03], Reverse Transcription System [Promega, A3500], qPCR Master Mix [Promega, A6002], radio-immunoprecipitation assay (RIPA) lysis buffer [Beijing Applygen,

(83) A novel role of TRIM28 B box domain in L1 retrotransposition and ORF2p-mediated cDNA synthesisNucleic Acids ResearchMay 22, 2023Qianhui Du, Emily C Stow, Dawn LaCoste, Benjamin Freeman, Melody Baddoo, Afzaal M Shareef, Kyle M Miller, Victoria P BelancioAAGATTTTCGCCACCTACAGCAGCGACAAG LEAP reverse primer: AGTGGCACCTTCCAGGGTCAAGGAA Regular RT-PCR Reverse Transcriptase System (Promega: A3500) was used according to manufacturer's instructions. Reactions were set up at 9 ul sample. Each sample

(84) Integrated transcriptomic analysis identifies coordinated responses to nitrogen and phosphate deficiency in riceFrontiers in Plant ScienceMay 8, 2023Fei Wang, Yan Wang, Luying Ying, Hong Lu, Yijian Liu, Yu Liu, Jiming Xu, Yunrong Wu, Xiaorong Mo, Zhongchang Wu, et al.(Invitrogen). First-strand cDNA was synthesized from 1 µg of total RNA using a reverse transcription system (A3500; Promega). qPCR was performed using SYBR Green I Master (Roche) on a LightCycler 480 Real-Time PCR system

(85) Impact of retrotransposon protein L1 ORF1p expression on oncogenic pathways in hepatocellular carcinoma: the role of cytoplasmic PIN1 upregulationBritish journal of cancerMarch 1, 2023Zadran B, Sudhindar PD, Wainwright D, Bury Y, Luli S, Howarth R, McCain MV, Watson R, Huet H, Palinkas F, et al.Fisher Scientific). Complementary DNA was generated using the cDNA Reverse Transcription Kit (Promega, A3500) as per the manufacturer’s instructions. The qRT-PCR was carried out as described previously [36]. Primers

(86) HOXB9 Overexpression Confers Chemoresistance to Ovarian Cancer Cells by Inducing ERCC-1, MRP-2, and XIAPInternational journal of molecular sciencesJanuary 8, 2023Suh DH, Park WH, Kim M, Kim K, No JH, Kim YB.manufacturer’s instructions. cDNA was synthesized from 2 µg of RNA using a reverse transcription kit (Cat# A3500, Promega, Madison, WI, USA), and the PCR was performed using 2× PCR Master mix Solution (Cat# 25027,

(87) Reduced Ribose-5-Phosphate Isomerase A-1 Expression in Specific Neurons and Time Points Promotes Longevity in Caenorhabditis elegansAntioxidants (Basel, Switzerland)January 4, 2023Shen WC, Yuh CH, Lu YT, Lin YH, Ching TT, Wang CY, Wang HD.protocol. The extracted RNA was reverse-transcribed through Reverse Transcription System (Promega, #A3500). We diluted cDNA in a ratio of 1:9 with ddH2O to perform quantitative PCR (qPCR) by StepOne Plus Real-time PCR system

(88) Moderate intrinsic phenotypic alterations in C9orf72 ALS/FTD iPSC-microglia despite the presence of C9orf72 pathological featuresFrontiers in cellular neuroscienceJanuary 1, 2023Lorenzini I, Alsop E, Levy J, Gittings LM, Lall D, Rabichow BE, Moore S, Pevey R, Bustos LM, Burciu C, et al.was reverse transcribed to cDNA with oligo(dT) with the Promega Reverse Transcriptase System (Cat # A3500) and analyzed using SYBR Green Master Mix (Applied Biosystems). C9orf72 (Forward- 5′- CAGTGATGTCGACTCTTTG−3′

(89) IP3R-dependent mitochondrial dysfunction mediates C5b-9-induced ferroptosis in trichloroethylene-caused immune kidney injuryFrontiers in immunologyJanuary 1, 2023Liu Z, Ma J, Zuo X, Zhang X, Xie H, Wang F, Wu C, Zhang J, Zhu Q.RNA was reverse-transcribed to cDNA using the reverse transcription system (Promega Corporation, Cat. A3500) following the instruction manual. Real-time PCR was carried out using LightCycler® 480 SYBR® Green I Master

(90) Dysregulated expression and distribution of Kif5α in neurites of wobbler motor neuronsNeural regeneration researchJanuary 1, 2023Kürten K, Gude AC, Christian Epplen AS, Stein J, Theiss C, Matschke V.protocol. cDNA was synthesized using Reverse Transcription System (Promega, Madison, WI, USA, Cat# A3500), as described in the manufacturer protocol using 1 μg tRNA and oligo(dT) primer. cDNA was stored at

(91) Early Divergence of the C-Terminal Variable Region of Troponin T Via a Pair of Mutually Exclusive Alternatively Spliced Exons Followed by a Selective Fixation in Vertebrate HeartJournal of Molecular EvolutionDecember 1, 2022Tianxin Cao, Shirin Akhter, J.-P. Jin1 μg of RNA from each muscle sample was reverse transcribed using random primer (Promega, catalog # A3500) and Superscript III reverse transcriptase (Invitrogen, catalog # 18080–044) at 50°C for 1 hr. Quantitative PCR

(92) The Impact of Deleting Stem-Loop 1 of Epstein–Barr Virus-Encoded RNA 1 on Cell ProliferationVirusesNovember 16, 2022Zubaida Hassan, Pretty S. Philip, Gulfaraz KhanUSA) protocols. A total of 5 µg RNA was DNase treated and reverse transcribed to cDNA using Promega A3500 kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. A total of 100 ng of gDNA/cDNA

(93) The Importance of Nutritional Aspects in the Assessment of Inflammation and Intestinal Barrier in Patients with Inflammatory Bowel DiseaseNutrientsNovember 2, 2022Olga Kaczmarczyk, Agnieszka DÄ…bek-Drobny, Agnieszka PiÄ…tek-Guziewicz, MichaÅ‚ WoÅºniakiewicz, PaweÅ‚ PaÅ›ko, Justyna Dobrowolska-Iwanek, Aneta WoÅºniakiewicz, Aneta Targosz, Agata Ptak-Belowska, Urszula Szczyrk, et al.Waltham, MA, USA). Reversed transcription to cDNA was performed using Reverse Transcription System A3500 (Promega Corporation). Reversed transcription was normalized for each reaction regarding the total RNA

(94) CLN7/MFSD8 may be an important factor for SARS-CoV-2 cell entryiScienceOctober 21, 2022Heinl ES, Lorenz S, Schmidt B, Nasser M Laqtom N, Mazzulli JR, Francelle L, Yu TW, Greenberg B, Storch S, Tegtmeier I, et al.Kit,Macherey-Nagel GmbH & Co. KG (DE),Cat#REF740955.250 Reverse Transcription System,Promega Corporation (US),Cat#A3500 Takyon™ No Rox SYBR® MasterMix dTTP Blue,Eurogentec (BE),Cat# UF-NSMT-B0701 HiYield® PCR Clean-up/Gel

(95) HIF-α activation by the prolyl hydroxylase inhibitor roxadustat suppresses chemoresistant glioblastoma growth by inducing ferroptosisCell death & diseaseOctober 8, 2022Su X, Xie Y, Zhang J, Li M, Zhang Q, Jin G, Liu F.manufacturer’s instructions. cDNA synthesis was performed using Reverse Transcription System Kit (Promega A3500, USA). The PCR amplification was carried out in triplicates with SYBR premix Ex Taq (Takara, Japan)

(96) Single-cell RNA sequencing uncovers a neuron-like macrophage subset associated with cancer painScience advancesOctober 7, 2022Tang PC, Chung JY, Liao J, Chan MK, Chan AS, Cheng G, Li C, Huang XR, Ng CS, Lam EW, et al.(Gibco). Quantitative real-time PCR TRI reagent (TR 118, Molecular Research Center), reverse transcription system (A3500, Promega), and SYBR Green Supermix (#1725124, Bio-Rad) were used for RNA extraction, complementary DNA

(97) C5b-9 mediates ferroptosis of tubular epithelial cells in trichloroethylene-sensitization miceEcotoxicology and environmental safetyOctober 1, 2022Liu Z, Ma J, Zuo X, Zhang X, Hong Y, Cai S, Huang H, Wang F, Wu C, Zhang J, et al.potential fluorescent probe (Cat. 40705ES03) was from Yeasen Biotech. Reverse transcription system (Cat. A3500) was from Promega Corporation. LightCycler® 480 SYBR® Green I Master (Cat. 04887352001) was from Roche. 2.2.

(98) Temperature modulation of CAMTA3 gene induction activity is mediated through the DNA binding domainThe Plant JournalOctober 1, 2022Lumen Chao, Yongsig Kim, Sarah J. Gilmour, Michael F. Thomashowused to synthesize cDNA with random oligonucleotides using a reverse transcription system (cat. no. A3500; Promega, https://www.promega.com) according to the manufacturer's instructions using a 20‐μl reaction

(99) FcÎ± Receptor-1-Activated Monocytes Promote B Lymphocyte Migration and IgA Isotype SwitchingInternational Journal of Molecular SciencesSeptember 22, 2022AmÃ©lie V. Bos, Melissa M. J. van Gool, Annelot C. Breedveld, Richard van der Mast, Casper Marsman, Gerd Bouma, Mark A. van de Wiel, S. Marieke van Ham, Reina E. Mebius, Marjolein van Egmondbelow 7.5 were excluded. Real-Time PCR. Reverse transcription of RNA was performed using the Promega A3500 kit according to the manufacturer’s instructions (Promega, Madison, WI, USA). Melt curves were recorded

(100) Plasmodium falciparum sexual conversion rates can be affected by artemisinin-based treatment in naturally infected malaria patientseBioMedicineSeptember 1, 2022Harvie P. Portugaliza et al.first-strand cDNA was synthesised by using the AMV Reverse Transcription System (Promega, cat. no. A3500), with both oligo (dT) and random primers included in the reaction.75 qPCR analysis To quantify transcript

Be the First to Write a Review!