Reverse Transcription System from Promega

Product Specs
ItemReverse Transcription System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3500
Quantity100 reactions
PrimersOligo(dT)₁₅ Primer and Random Primers

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(501) Potent Synergistic Effect of Doxycycline with Fluconazole against Candida albicans Is Mediated by Interference with Iron HomeostasisAntimicrobial Agents and ChemotherapyJuly 1, 2012Alessandro Fiori, Patrick Van Dijckthen outgrown for 4 h before RNA extraction. cDNA was prepared from DNase-treated RNA samples with the Promega A3500 reverse transcription kit. Quantitative PCR was performed on a StepOne Plus real-time FIG 1 Doxycycline

(502) Reprogramming human amniotic fluid stem cells to functional pluripotency by manipulation of culture conditionsProtocol ExchangeJune 28, 2012Pascale GUILLOT, Dafni Moschidou, Pascale V GuillotRNAase-free DNAase set \(Qiagen, cat. no. 79254) • Reverse transcription system \(Promega, cat. no. A3500) • SYBR green PCR mastermix \(Applied Biosystems, cat. no. 4364346) • Custom oligonucleotides \(Thermo)

(503) Demethylation of the Coding Region Triggers the Activation of the Human Testis-Specific PDHA2 Gene in Somatic TissuesPLoS ONEJune 1, 2012Ana Pinheiro, Maria João Nunes, Inês Milagre, Elsa Rodrigues, Maria João Silva, Isabel Tavares de Almeida, Isabel RiveraRNase-free DNase Set (Qiagen). Total RNA was reverse transcribed using the Reverse Transcription System A3500 Kit (Promega) with random primers following the manufacturer's instructions. First strand DNA (1 µg)

(504) Nociceptin/orphanin FQ inhibition with SB612111 ameliorates dextran sodium sulfate-induced colitisEuropean Journal of PharmacologyMay 15, 2012Carsten Alt, Jennifer S. Lam, M. Travis Harrison, Kathleen M. Kershaw, Steven Samuelsson, Lawrence Toll, Annalisa D'AndreaScientific, Wilmington, DE). RNA templates (~100 ng) were amplified with a reverse transcription kit (A3500 kit; Promega, Madison, WI) using anchored oligo-dT primers (IDT, Coralville, IA) according to the manufacturer’s

(505) Immune genes undergo more adaptive evolution than non-immune system genes in Daphnia pulexBMC Evolutionary BiologyMay 11, 2012Seanna J McTaggart, Darren J Obbard, Claire Conlon, Tom J Littlewith RNAase-free DNAase (Promega). cDNA was synthesized in 20ul volumes using the Promega RT system (A3500) and subsequently diluted five-fold in ultrapure water. Two ul of this solution was used in a 20ul PCR

(506) A bioinformatics method identifies prominent off-targeted transcripts in RNAi screensNature MethodsApril 1, 2012Frederic D. Sigoillot, Susan Lyman, Jeremy F. Huckins, Britt Adamson, Eunah Chung, Brian Quattrochi, Randall W. Kingwas generated by reverse transcribing the total RNAs using a reverse transcription system (Promega, A3500) following manufacturer’s protocol. MAD2 mRNA sequences were PCR amplified from the cDNA library. The

(507) The Influence of Dietary Calcium and Phosphorus Imbalance on Intestinal NaPi-IIb and Calbindin mRNA Expression and Tibia Parameters of BroilersAsian-Australasian Journal of Animal SciencesApril 1, 2012Jianhui Li, Jianmin Yuan, Yuming Guo, Qiujuan Sun, Xiaofei HuAMV Reverse Transcriptase using an Oligo (dT)15 primer in the presence of Recombinant RNasin Ribonuclease Inhibitor (A3500, Promega Corp.). Real-time PCR of NaPi-IIb and calbindin mRNA was performed with β-actin as internal

(508) Modulation of apoptosis in human hepatocellular carcinoma (HepG2 cells) by a standardized herbal decoction of Nigella sativa seeds, Hemidesmus indicus roots and Smilax glabra rhizomes with anti- hepatocarcinogenic effectsBMC complementary and alternative medicineMarch 29, 2012Samarakoon SR, Thabrew I, Galhena PB, Tennekoon KH.chemicals were purchased from Sigma Aldrich (Gillingham, Dorset, UK). M-MLV reverse transcriptase system (A3500), and GoTaq DNA polymerase, were purchased from Promega Cooperation, Madisons, U.S.A. PCR primers were

(509) Effects of yeast cell walls on performance and immune responses of cyclosporine A-treated, immunosuppressed broiler chickensBritish Journal of NutritionMarch 28, 2012Shaojin Zhang, Bingling Liao, Xiao Li, Lei Li, Libao Ma, Xianghua Yanconcentrations. Each total RNA sample (2 mg) was reverse transcribed (Promega’s Reverse Transcription System no. A3500) according to the manufacturer’s instructions. Quantitative real-time PCR analysis of spleen IL-1b,

(510) Effect of Standardized Decoction of Nigella sativa Seed, Hemidesmus indicus Root and Smilax glabra Rhizome on the Expression of p53 and p21 Genes in Human Hepatoma Cells (HepG2) and Mouse Liver with Chemically-Induced HepatocarcinogenesisTropical Journal of Pharmaceutical ResearchMarch 12, 2012SR Samarakoon, I Thabrew, PB Galhena, KH TennekoonShimadzu, Japan). Each sample of isolated RNA was reversetranscribed by M-MLV reverse transcriptase system (A3500, Promega Cooperation, Madisons, U.S.A) to synthesize single stranded cDNA as follows. RNA sample (2µg) was

(511) Methodology for Anti-Gene Anti-IGF-I Therapy of Malignant TumoursChemotherapy Research and PracticeFebruary 14, 2012Jerzy Trojan et al.applied components of RT PCR were used according Reverse Transcription System Promega Corporation (no. A3500). The following primers were used for RT PCR study of human IGF-I: forward primer IGF-I: GCATCTCTTCTACCTGGCGCTG,

(512) A Regulatory Network for Coordinated Flower MaturationPLoS GeneticsFebruary 9, 2012Paul H. Reeves et al.4 hours after subjective dawn. cDNA was synthesized using the Reverse Transcription System (Promega A3500) with random primers according to the manufacturer’s instructions. 0.1 mg of total RNA was used for

(513) A modified protocol for in vitro maturation of mouse oocytes from secondary preantral folliclesAdvances in Bioscience and BiotechnologyJanuary 1, 2012Weidong Wang, Yaxu Tang, Lujuan Ni, Theerayut Jongwutiwes, Hung-Ching Liu, Zev Rosenwaksinactivated. Reverse transcription was carried out according to the manufacturer’s instruction (Promega, USA; A3500). RNA expression levels were quantified using semi-quantitative RT-PCR. cDNA levels were normalized

(514) Regulation ofLYRM1Gene Expression by Free Fatty Acids, Adipokines, and Rosiglitazone in 3T3-L1 AdipocytesExperimental Diabetes ResearchJanuary 1, 2012Min Zhang et al.260 nm. cDNA was synthesized from 1 μg of total RNA using an AMV Reverse Transcriptase Kit (Promega A3500; Promega, Madison, Wis, USA), according to the manufacturer’s instructions. Real-time RT-PCR was performed

(515) Microarray Screening for Novel Preeclampsia Biomarker CandidatesFetal Diagnosis and TherapyJanuary 1, 2012Olav Lapaire, Simon Grill, Sebastien Lalevee, Varaprasad Kolla, Irene Hösli, Sinuhe HahnRNA according to the manufacturer’s instructions using the Promega Reverse Transcription System (No. A3500). We were able to design oligonucleotides for 12 out of 14 potential biomarkers using the program Primer3

(516) Ex vivo IL-1 receptor type I expression in human CD4+ T cells identifies an early intermediate in the differentiation of Th17 from FOXP3+ naive regulatory T cellsJournal of immunology (Baltimore, Md. : 1950)November 15, 2011Raffin C, Raimbaud I, Valmori D, Ayyoub M.on-column digestion of DNA (Qiagen). cDNA synthesis was performed using Promega Reverse Transcription System A3500 (Promega). Quantitative PCR was performed with a TaqMan assay on an ABI 7000 system (Applied Biosystems)

(517) Enzymatic activity of free-prostate-specific antigen (f-PSA) is not required for some of its physiological activitiesThe ProstateNovember 1, 2011Kailash C. Chadha, Bindukumar B. Nair, Srikant Chakravarthi, Rita Zhou, Alejandro Godoy, James L. Mohler, Ravikumar Aalinkeel, Stanley A. Schwartz, Gary J. Smithwas reverse transcribed to cDNA using a reverse transcriptase kit from Promega (Promega, Inc.; Cat #A3500). Relative abundance of each mRNA species was quantitated using real time quantitative PCR using specific

(518) The altered expression of inflammation-related microRNAs with microRNA-155 expression correlates with Th17 differentiation in patients with acute coronary syndromeCellular & Molecular ImmunologyNovember 1, 2011Rui Yao et al.out according to the manual for the Reverse Transcription System, which was purchased from Promega (#A3500). The reagent mixes were incubated at 16 uC for 30 min, 42 uC for 42 min and 95 uC for 5 min. cDNA samples

(519) Resveratrol triggers the pro-apoptotic endoplasmic reticulum stress response and represses pro-survival XBP1 signaling in human multiple myeloma cellsExperimental hematologyOctober 1, 2011Wang FM, Galson DL, Roodman GD, Ouyang H.instructions. Reverse transcription was conducted using a reverse transcription system kit (Promega, Cat.A3500). An aliquot of the product cDNA was used for real-time PCR with iQ™ SYBR Green Supermix and iCycler

(520) Overexpression of minichromosome maintenance 2 predicts poor prognosis in patients with gastric cancerOncology ReportsSeptember 22, 2011Chun Yang et al.visualized under UV light. One microgram of RNA was reverse transcribed into complementary DNA using an A3500 RT-PCR system (Promega Corp., Madison, WI, USA). Real-time PCR was performed using an ABI Prism 7500

Page
<<
<
26
27
28
29
30
>
>>

Reviews

Be the First to Write a Review!

Reverse Transcription System from Promega

Supplier Page View Company Product Page

Product Specs
Company Info
Citations
Reviews

Back To Top