Reverse Transcription System from Promega

Product Specs
ItemReverse Transcription System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3500
Quantity100 reactions
PrimersOligo(dT)₁₅ Primer and Random Primers

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(441) Antidepressant-like effects of Chaihu-Shugan-San via SAPK/JNK signal transduction in rat models of depressionPharmacognosy magazineJuly 1, 2014Li YH, Zhang CH, Qiu J, Wang SE, Hu SY, Huang X, Xie Y, Wang Y, Cheng TL.Ltd.. The Revert Aid First Strand cDNA Synthesis kit was obtained from Promega (Madison, WI, USA) (A3500 29287) and primers were synthesized by Shanghai Bio-engineering Technology Co., Ltd. JNK (p-JNK) rabbit

(442) PU.1 is essential for MLL leukemia partially via crosstalk with the MEIS/HOX pathwayLeukemiaJuly 1, 2014J Zhou et al.the TRIzol Reagent (15596018, Invitrogen, Carlsbad, CA, USA) and the Reverse Transcription System (A3500, Promega, Madison, WI, USA), respectively, according to manufacturer’s instructions. Gene-expression

(443) GATA3 cooperates with PARP1 to regulate CCND1 transcription through modulating histone H1 incorporationOncogeneJune 12, 2014Shan L, Li X, Liu L, Ding X, Wang Q, Zheng Y, Duan Y, Xuan C, Wang Y, Yang F, et al.and used for ﬁrst-strand complementary DNA synthesis with the Reverse Transcription System (Promega, A3500). Quantitation of all gene transcripts & 2014 Macmillan Publishers Limited PARP1 regulates GATA3

(444) Activation of Cold-Sensing Transient Receptor Potential Melastatin Subtype 8 Antagonizes Vasoconstriction and Hypertension Through Attenuating RhoA/Rho Kinase PathwayHypertensionJune 1, 2014Jing Sun et al.USA). RNA was used to synthesize the first-strand cDNA using the Reverse Transcription System (Promega A3500, USA; online-only Data Supplement). Measurement of Vascular Reactivity Vascular reactivity of freshly

(445) Detection of mutations in KLHL3 and CUL3 in families with FHHt (familial hyperkalaemic hypertension or Gordon's syndrome)Clinical ScienceMay 1, 2014Mark Glover et al.instructions. The RNA was then transcribed using a Promega AMV reverse transcriptase kit (catalogue number A3500) according to manufacturer’s instructions using either random primers (RT1) or a CUL3-specific primer

(446) The Effects of Cigarette Smoke Extract on Ovulation, Oocyte Morphology and Ovarian Gene Expression in MicePLoS ONEApril 28, 2014Zixin Mai, Ming Lei, Bolan Yu, Hongzi Du, Jianqiao Liuin the ovarian samples. First, cDNA was synthesized using the Reverse Transcription System (Promega A3500; Madison USA) according to the manufacturer’s instructions. Briefly, 2 ml of total RNA was reverse transcribed

(447) Yiqi Huoxue Recipe Improves Heart Function through Inhibiting Apoptosis Related to Endoplasmic Reticulum Stress in Myocardial Infarction Model of RatsEvidence-Based Complementary and Alternative MedicineApril 17, 2014Li-Xia Lou et al.Chemicals and Drugs. Trizol was purchased from Invitrogen (CA, USA). Reverse transcription system (A3500) was purchased from Promega (WI, USA). The ab21685-100 antibody against GRP78 and the antibody against

(448) Embryonic Protein Undernutrition by Albumen Removal Programs the Hepatic Amino Acid and Glucose Metabolism during the Perinatal Period in an Avian ModelPLoS ONEApril 16, 2014Els Willems, Tjing-Tjing Hu, Laura Soler Vasco, Johan Buyse, Eddy Decuypere, Lutgarde Arckens, Nadia EveraertEurope GmbH, Dueren, DE). The RNA was transcribed into cDNA using the Reverse Transcription system (A3500, Promega, Madison, WI, USA). Denaturation was performed for 3 min at 80°C followed by 45 min at 42°C

(449) Polμ Deficiency Increases Resistance to Oxidative Damage and Delays Liver AgingPLoS ONEApril 1, 2014Beatriz Escudero et al.TRI REAGENT (Sigma, P/N: T9424). cDNA was synthesized using the Reverse Transcription kit (Promega, P/N: A3500). Gene expression was evaluated by TaqMan assay and mRNA levels were normalized to a standard housekeeping

(450) Ubiquitin-like with PHD and ring finger domains 2 is a predictor of survival and a potential therapeutic target in colon cancerOncology ReportsApril 1, 2014SU LU, DONGWANG YAN, ZEHUA WU, TAO JIANG, JIAN CHEN, LIN YUAN, JUN LIN, ZHIHAI PENG, HUAMEI TANGmicrogram of total RNA from each sample was subjected to first-strand complementary DNA synthesis using an A3500 RT-PCR System® according to the recommendations of the manufacturer (Promega Corporation, Madison, WI,

(451) Ectopic expression of Sonic Hedgehog in a cryptorchid man with azoospermia: A case reportJournal of International Medical ResearchApril 1, 2014Shasha Zou, Yanan Wang, Tingting Chen, Pingping Song, Daiying Xin, Ping Ping, Yiran Huang, Zheng Li, Hongliang Huthe manufacturer’s instructions. The RT reaction was performed using the Reverse Transcription System A3500 kit provided by Promega (Madison, WI, USA). Quantitative real-time RT–PCR was conducted with 10 ml SYBRÕ

(452) Seed-Specific Expression of a Lysine-Rich Protein Gene, GhLRP, from Cotton Significantly Increases the Lysine Content in Maize SeedsInternational Journal of Molecular SciencesMarch 27, 2014Jing Yue, Cong Li, Qian Zhao, Dengyun Zhu, Jingjuan YuAbout 2 μg of total RNA was reverse-transcribed to cDNA using the Reverse Transcription System (Promega A3500, Fitchburg, WI, USA), according to the manufacturer’s protocol. RT-PCR was performed using 1 μL cDNA,

(453) JMJD6 promotes colon carcinogenesis through negative regulation of p53 by hydroxylationPLoS biologyMarch 1, 2014Wang F, He L, Huangyang P, Liang J, Si W, Yan R, Han X, Liu S, Gui B, Li W, et al.(Invitrogen) and used for first strand cDNA synthesis with the Reverse Transcription System (Promega, A3500). Quantitation of all gene transcripts was done by qPCR using Power SYBR Green PCR Master Mix and an

(454) Regulation of Mcl-1 by constitutive activation of NF-κB contributes to cell viability in human esophageal squamous cell carcinoma cellsBMC cancerFebruary 17, 2014Liu H, Yang J, Yuan Y, Xia Z, Chen M, Xie L, Ma X, Wang J, Ouyang S, Wu Q, et al.First-strand cDNA was synthesized from 2 μg of total RNA using the Reverse Transcription System Kit (Cat. No. A3500, Promega, Madison, WI). The resulted cDNA was subjected to PCR (94°C for 5 min followed by 34 cycles

(455) Oleate promotes differentiation of chicken primary preadipocytes in vitroBioscience ReportsFebruary 1, 2014Zhouchun Shang, Lin Guo, Ning Wang, Hui Shi, Yuxiang Wang, Hui Limanufacturer’s instructions. First-strand cDNA synthesis was performed with 1 μg total RNA (Promega A3500). To detect the expression of chicken adipogenesis-related genes, quantitative real-time PCR was performed

(456) Evaluating The Efficacy Of Gene Silencing In Dopaminergic Neuronal Cells In-vitro Using Gold Nanorods (GNR) With Different Surface Properties Complexed To DARPP-32 SiRNAJournal of Advanced Pharmaceutical Science And TechnologyJanuary 23, 2014Atcha Kopwitthaya, Wing Cheung Law, Lisa A Vathy, Ravikumar Aalinkeel, Jessica L. Reynolds, Bindukumar Nair, Supriya D. Mahajanis reverse transcribed to cDNA using the reverse transcriptase kit from Promega (Promega Inc, Madison, WI; Cat # A3500). Relative gene expression of DARPP32 is calculated using the comparative CT method with 4, 20, 40

(457) Immunotherapy of Malignant Tumors Using Antisense Anti-IGF-I Approach: Case of GlioblastomaJournal of Cancer TherapyJanuary 1, 2014Annabelle Trojan, Lina M. Jay, Heliodor Kasprzak, Donald D. Anthony, Jerzy Trojanapplied components of RT PCR were used according Reverse Transcription System Promega Corporation (n˚ A3500. The following primers were used for RT PCR study of human IGF-I: Forward primer IGF-I: GCATCTCTTCTACCTGGCGCTG,

(458) Qingkailing Suppresses the Activation of BV2 Microglial Cells by Inhibiting Hypoxia/Reoxygenation-Induced Inflammatory ResponsesEvidence-based complementary and alternative medicine : eCAMJanuary 1, 2014Mana L, Wang S, Zhu H, Xing Y, Lou L, Wu A, Dong B, Sun Y, Yang S, Wang L, et al.China. Trizol reagent was purchased from Invitrogen Corporation, USA. The Reverse Transcription System (A3500 kit) was purchased from Promega Corporation, USA. The Power SYBR Green PCR Master Mix kit was purchased from

(459) Regulation of MEIS1 by distal enhancer elements in acute leukemiaLeukemiaJanuary 1, 2014Qian-fei Wang et al.with DNaseI Turbo kit (Ambion, AM1907). The cDNA was then obtained by reverse transcription (Promega A3500) and real-time PCR was performed. The gene expression level was normalized with the expression of the

(460) ACE inhibitors potently reduce vascular inflammation, results of an open proof-of-concept study in the abdominal aortic aneurysmPloS oneJanuary 1, 2014Kortekaas KE, Meijer CA, Hinnen JW, Dalman RL, Xu B, Hamming JF, Lindeman JH.(Campro Scientific, Veenendaal, The Netherlands) and glass beads. [22] Copy-DNA was prepared using kit #A3500 (Promega, Leiden, The Netherlands) and quantitative real-time polymerase chain reaction (Taqman system)

Be the First to Write a Review!