pRL-SV40 Vector from Promega

Product Specs
ItempRL-SV40 Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2231
HostMammalian
ResistanceAmpR
PromoterSV40 early enhancer/promoter
Vector NamepRL-SV40
Quantity20microg
ReporterRenilla luciferase
Molecular Weight~73kDa
Selectable MarkerAmpicillin

Specifications/Features

Vector Size:
3705 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) A microRNA expression signature in infant t(4;11) KMT2A::AFF1+ BCP-ALL uncovers novel therapeutic targetsHemasphereApril 23, 2026Camille Malouf, Alasdair Duguid, Kirsten S. Vrenken, Tom Leah, Ragini Medhi, Giuseppina Camiolo, Leslie Nitsche, Hélène Jakobczyk, Rishi S. Kotecha, Richard A. Anderson, et al.each well consisted of 98 ng of the pGL3‐promoter, 100 ng of pMIRH, and 2 ng of pRL‐SV40 (Promega Cat# E2231) in 100 µL of serum‐free DMEM and 1 mg/mL of polyethyleneimine, high molecular weight (Sigma‐Aldrich

(2) A Novel Mechanism for Depot-Specific Leptin Gene Expression Regulation and its Persistence After Weight LossiScienceApril 17, 2026Natalie Taege, Jan Hendric Britsemmer, Andreas Israel, Christin Krause, Sina Junge, Annette Feuchtinger, Siegfried Ussar, Paul Thomas Pfluger, Timo Gemoll, Sonja Charlotte Schriever, et al.US",CATGGTGTTAGGACACCGCTGTGGGAAAAACCGCTGGTCACGATGATGCCAGAA pRL-SV40 (Renilla SC40 plasmid),"Promega, US",E2231 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, CpG-free plasmid pCpGL-CMV,44,N/A Luci-RS1-CpGfree,created

(3) GV1001 Reprograms CD47 Immune Checkpoint to Restore Macrophage Antitumor Activity in Oral Squamous Cell CarcinomaInt J Mol SciApril 7, 2026Wei Chen, Seojin Kim, Cheyenne Beheshtian, Angela Jun, Sangjae Kim, No-Hee Park(Thermo Fisher Scientific, cat. no. 11668), together with 50 ng of the pRL-SV40 vector (Promega, cat. no. E2231, Madison, WI, USA) encoding renilla luciferase as an internal control. Cell lysates were harvested,

(4) Exosomal transfer of macrophage-derived NEAT1 enhances DNA damage response and confers cisplatin resistance in lung adenocarcinoma via the MAD1L1/p53 axisInt J Biol SciMarch 25, 2026Yi Yang, Min Meng, Yi Zhao, Fangyuan Yu, Harsh Patel, Zhe-Sheng Chengene plasmid was constructed using the pGL3-Basic plasmid, and Renilla luciferase plasmid pRL-SV40 (E2231, Promega) was co-transfected at 1:10 ratio for normalization. The promoter region of MAD1L1 is a 2000

(5) p53-induced RNA-binding protein ZMAT3 inhibits transcription of a hexokinase to suppress mitochondrial respiration in human cancer cellseLifeMarch 17, 2026Ravi Kumar, Simon Couly, Bruna R Muys, Xiao Ling Li, Ioannis Grammatikakis, Ragini Singh, Mary Guest, Xinyu Wen, Wei Tang, Stefan Ambs, et al.co-transfected with 250 ng of pGL4 or pGL4-HKDC1-intron 1 and 25 ng of pRL-TK (Promega, Catalog no. E2231), together with 20 nM of either AllStars Negative Control siRNA, siJUN or siZMAT3. Lipofectamine 2000 transfection reagent

(6) Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia riskGenome BiolMarch 9, 2026Manvendra Singh, Yuliang Qu, Amit Pande, Julianna Zadora, Florian Herse, Martin Gauster, Xuhui Kong, Rongyan Zheng, Rabia Anwar, Katarina Stevanovic, et al.104 cells/well) for 24 h were co-transfected with the internal control pRL-SV40 Vector (50 ng/well, #E2231 Promega) and candidate plasmids (250 ng/well) using the jetPRIME®transfection reagent (#114–15, Polyplus Transfection

(7) ALDH2 inhibits head and neck tumorigenesis through RAS signaling suppression, transactivation of TGM2, and synergy with ALDH6A1Cellular and Molecular Life SciencesFebruary 21, 2026Uyanahewa Gamage Shashini Janesha, Chang-Ta Chiu, Ming-Hsien Tsai, Keng-Ming Chang, Chih-Yen Chien, Hui-Shan Huang, Hao-Yi Li, Yao-Chung Yang, Hui Lu, Cheng-Tang Pan, et al.ratio of pGL4.32[luc2P/NF-κB-RE/Hygro] (700 ng) to pRL Renilla Luciferase Control Reporter Vector (E2231, Promega, control) (50 ng) was maintained at 14:1. Luminescence signals were measured using the GloMax® 20/20 Luminometer

(8) LDB1 represses fetal hemoglobin expression by enhancing BCL11A transcriptionRedox BiolFebruary 4, 2026Si-Won Park, Chang-Yong Choi, In-Byung Park, Seok-Jin Kang, Hyeon Jeong Lee, Ji-In Kim, Joonbeom Bae, Dongho Geum, Yong-Pil Cheon, Taehoon Chunvector (100 ng) containing either Bcl11a intron #3 or Bcl11a intron #4, and the pRL-SV40 vector (Promega E2231, 100 ng) containing the internal Renilla luciferase were co-transfected, along with the indicated combinations

(9) Bifidobacterium Infantis Promotes FOSL1-Mediated Transcriptional Repression of VDR to Accelerate Autoimmune Pancreatitis Progression Through Activation of Oxidative StressInflammationJanuary 23, 2026Jie Tang, Qin Li, Kai Li, Dongyun Hang, Danyin Gu, Lingmei Feng, Guoyu Chen, Ming Xuco-transfected into pDCs with the internal reference, pRL Renilla Luciferase Control Reporter Vectors (E2231, Promega) using DOTAP liposome transfection reagent. After 48 h of incubation, the pDCs were lysed,

(10) USP10 promotes glioma stem cell maintenance and glioblastoma growth by antagonizing DTX3L-mediated SATB2 ubiquitinationNature CommunicationsJanuary 8, 2026Mengyue Guo, Wenlong Luo, Peng Ling, Hong Lei, Lihua Li, Chao Duan, Zhen Xue, Min Zhang, Xiaoyan Zhang, Wendai Bao, et al.plasmid or mutant plasmid, Flag-YY2 overexpression vector, and pRL internal control vector (Promega, Cat# E2231). Luciferase activities were detected 48 hours post-transfection using the Dual-Luciferase® Reporter Assay System

(11) IRF4 haploinsufficiency in a multiplex family with Whipple’s diseaseJournal of Human ImmunityJanuary 5, 2026Sinem Ünal, Stéphanie Dublanc, Hailun Li, Jean-Philippe Vernhes, Vincent Meynier, Camille Soudée, Whipple’s consortium, Achille Aouba, Sylvain Audia, Nabil Bel Feki, et al.backbone, Addgene #102597) (100 ng/well and 100 μL DMEM-10% FBS medium), the pRL-SV40 vector (Promega, #E2231, 40 ng/well) and IRF4 WT or IRF4 mutant pcDNA3.1D V5-His-TOPO IRF4 plasmid (0.5 ng/well), with X-tremeGENE™ 9 DNA Transfection Reagent

(12) Neuroprotective effects of hyperbaric oxygen therapy on vascular cognitive impairment in hypoperfused mice via miR-137-3p/TRAF3 pathwayTranslational PsychiatryNovember 29, 2025Lu Yang, Hou-Ze Zhu, Liang Xie, Jun Yang, Hai-Tang Wei, Qun-Tao Yu, Hao Li, Ming Yang, Zhe LiChina).Firefly-tagged pGL3 promoter luciferase vector (#E1761) and the Renilla control luciferase vector (#E2231) were obtained from Promega Co.(WI,USA). Virus overexpressing TRAF3 (#MCP296365) and control virus were

(13) A non-coding ABO regulatory variant associatedwith VWF levels, thrombosis risk, and COVID-19 severity is topologically linked to ADAMTS13 in endothelial cellsHuman Genetics and Genomics AdvancesNovember 27, 2025Douglas Victorino Esposito, Hellen Ferreira de Souza Ferreira de Souza Sobrinho, Marcelo Rocha Marquesmedium was replaced. All wells were co-transfected with the pRL-SV40 plasmid (Promega, catalog no. E2231) to normalize luminescence readings. Cells were transfected with 100 ng plasmid containing one of the

(14) Activation of WDHD1 by DNA demethylases promotes MINPP1 transcription and glycolysis in lung adenocarcinoma progressionRespiratory ResearchNovember 25, 2025Guibin Zhao, Haiyan Liu, Daolin Ji, Xiao Ma, Gang TanWatertown, MA, USA) between the SacI and HindIII sites. pRL Renilla Luciferase Control Reporter Vectors (E2231, Promega Corporation, Madison, WI, USA) were used as a control. A549 and PC-9 cells (2 × 104 cells/well)

(15) Translational readthrough therapy for ADPKD induces polycystin1 expression and partially rescues functional deficits in PKD1 mutant cellsScientific ReportsNovember 22, 2025Elena Torban, Lucie Canaff, Sima Babayeva, Nadezda Kachurina, Chen-Fang Chung, Albert C. M. Ong, Ahsan Alam, Paul R. Goodyer(Addgene plasmid # 26280); Renilla Luciferase (R-Luc vector driven by the SV40 promoter, Promega, Car# E2231). Cell culture and transfection All experiments with human cells were covered by the Research Institute

(16) A combined genomic arrhythmia propensity score delineates cumulative riskCell Reports MedicineNovember 18, 2025Tanner O. Monroe, Megan J. Puckelwartz, Lorenzo L. Pesce, Samuel D. Kearns, Patrick Page, Nora Ibrahim, Zachary T. Weber, Emmanuel I. Ugwor, Marcelo A. Nóbrega, Prince Kannankeril, et al.pGL4.23-GW,Pasquali et al.121,Addgene plasmid #60323 pRL-SV40 Renilla luciferase plasmid,Promega,cat# E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, DRAGEN fastQC v0.11.9,Illumina,https://support.illumina.com/content/dam/illumina-support/help/Illumina_DRAGEN_Bio_IT_Platform_v3_7_1000000141465/Content/SW/Informatics/Dragen/FASTQC_Intro_fDG.htm Burrows-Wheeler

(17) Impaired cAMP–PKA–CREB1 signalling drives mitochondrial dysfunction in skeletal muscle during cancer cachexiaNature MetabolismNovember 12, 2025Elia Angelino, Lorenza Bodo, Roberta Sartori, Valeria Malacarne, Beatrice D’Anna, Nicolò Formaggio, Suvham Barua, Tommaso Raiteri, Andrea Lauria, Simone Reano, et al.(pGL4.32[luc2P/NF-kB-RE/Hygro]; Promega; E8491) and pRL-null Vector (Renilla Luciferase Control Reporter Vector) (Promega; E2231), with a 10:1 ratio (luc/renilla). For transfection, ViaFect transfection reagent (Promega; E4982) was

(18) Haplotype-resolved genomics identifies cyp19a1a as a candidate master sex-determining gene in golden trevally (Gnathanodon speciosus)iScienceOctober 17, 2025Bin Fan, Jiamin Guo, Caixia Lei, Sen Yang, Zining Meng, Junyao Peng, Yongjian Yang, Yubang Shen, Yuanyou Li, Le WangKit,Sangon Biotech,Cat#B110022-0002 pGL3-Basic plasmid,Promega,Cat#E1751 pRL Renilla plasmid,Promega,Cat#E2231 Lipofectamine 3000,Thermo Fisher,Cat#L3000015 TRIzol™ Reagent,Thermo Fisher,Cat#15596018 PCR master

(19) ZNF184-mediated transcriptional activation of SAE1 drives the cell cycle entry and immune evasion in non-small cell lung cancerRespiratory ResearchSeptember 29, 2025Feng Shi, Luquan Zhang, Chunli Wang, Qingwei Mengusing Lipofectamine 3000 (Thermo Fisher) with 10 ng of pRL Renilla Luciferase Control Reporter Vectors (E2231, Promega Corporation, Madison, WI, USA). After 48 h of transfection, luciferase activity was detected

(20) Heterozygous TBX2 frameshift variants cause a novel syndromic hearing loss with incompletely penetrant nystagmusJ Med GenetSeptember 17, 2025Wan Hua, Yanfei Wang, Xiang Li, Wenyu Xiong, Lanchen Wang, Meilin Chen, Fengxiao Bu, Libo Liu, Fangyi Chen, Mingjun Zhong, et al.Promega) that contained four palindromic T-box binding site sequences (AATTTCACACCTAGGTGTGAAATT), pRL-TK (E2231, Promega) was used as the internal reference reporter plasmid. Transcriptional activity assay was performed

Be the First to Write a Review!

pRL-SV40 Vector

pRL-SV40 Vector from Promega

Description

Specifications/Features

Promega

Citations (295)

Reviews

pRL-SV40 Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map