pRL-SV40 Vector from Promega

Product Specs
ItempRL-SV40 Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2231
HostMammalian
ResistanceAmpR
PromoterSV40 early enhancer/promoter
Vector NamepRL-SV40
Quantity20microg
ReporterRenilla luciferase
Molecular Weight~73kDa
Selectable MarkerAmpicillin

Specifications/Features

Vector Size:
3705 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Autoantibodies against type I interferons in patients with zoonotic H7N9 influenza: an observational case-control studyEBioMedicineJuly 16, 2026Yongkun Chen, Jakob Ankerhold, Tingting Jia, Martin Wolkewitz, Jonas Fuchs, Lifang Yuan, Tian Bai, Kevin Groen, Roger Kuratli, Benjamin G. Hale, et al.control of five copies of the IFN-stimulated response element (ISRE) promoter, 4 ng of pRL-SV40 (Promega, E2231), constitutively expressing Renilla luciferase to normalise transfection efficiency, and 20 ng of empty

(2) Smad2 Preserves Corneal Stromal Homeostasis by Restraining Profibrotic Smad3/YAP/TEAD2 Transcriptional ProgramCellsJuly 2, 2026Ruimei Zhou, Dunpeng Cai, Shi-You Chenreporters and a constitutive Renilla luciferase internal control (pRL-TK, Promega, Madison, WI, USA, #E2231) using Lipofectamine 3000. The reporters used were SBE4-Luc (Addgene plasmid, #16495, a Smad3/4-responsive

(3) Cerebellar microRNA-206 tunes Purkinje neuron firing dynamics to control sensorimotor gatingbioRxivJune 30, 2026Mary P. Heyer, Masago Ishikawa, Junshi Wang, John Erol Evangelista, Amanda K. Fakira, Avi Ma'ayan, Guoping Feng, Paul J. Kenny(firefly-luciferase),"Lu et al., 2007",N/A pcDNA3.1(+)-luc-miR-206-sensor,This paper,N/A pRL-SV40,Promega,E2231 "pEMS-2115 (AAV2, Ple155!Pcp2-emGFP-WPRE)","Korecki et al., 2021",Addgene plasmid #49140 RRID:Addgene_49140 pAAV-Pcp2-MCS-emGFP,This

(4) ZEB1 drives terminal erythroid maturation by controlling the GATA2-KLF1 regulatory switchNucleic Acids ResJune 23, 2026Alexia Kinoo, Virginie Deleuze, Mohammad Salma, Noémie Legoff, Jérémie Candotti, Pedro Gonzalez-Menendez, Axel Joly, Jérémy Galtier, Julie Charmeaux-Goulot, Sanjay Chahar, et al.GATA2 enhancer were transfected in HEK293T cells together with expression plasmids and pRL-TK (cat# E2231, Promega) for internal normalization. Cell lysates were prepared and Firefly and Renilla luciferase

(5) RBM12 Maintains Glioma Stem Cells by Activating Amino Acid‐Dependent mTORC1 Signaling via SLC7A5 mRNA StabilizationAdvanced ScienceJune 22, 2026Hong Lei, Wenlong Luo, Shu Zhou, Lihao Wan, Peng Ling, Zhihua Huang, Zhihua Qian, Chenfei Lu, Mengyue Guo, Zhen Xue, et al.were co‐transfected with corresponding plasmids and the pRL internal control vector (Promega, Cat# E2231). To ensure equal amounts of DNA in all transfection combinations, the appropriate control vector was

(6) EBF1 Deficiency Drives Prostate Cancer Progression by Interfering with the Transcriptional Regulation of ITPR1Oncology ResearchJune 16, 2026Yuan Guo, Hui Wang, Xiaoyu Zhao, Xiao Feng, Xingjian Cai, Wei Li, Xiaohui Luoor mutant reporter plasmids and 0.02 μg pRL-TK Renilla reporter plasmids (Promega, Beijing, China, #E2231) were cotransfected into EBF1-null 293T cells (Applied Biological Materials, #T3005391), along with

(7) Bacteroides-derived endocannabinoid-like commendamide attenuates skeletal muscle ferroptosis in vitro: implications for Duchenne muscular dystrophyJournal of Translational MedicineJune 6, 2026Noemi Di Muraglia, Martina De Vito, Elisabetta Panza, Ester Pagano, Rosa Maria Vitale, Fabiana Piscitelli, Rosaria Villano, Raffaele Capasso, Vincenzo Pota, Caterina Pace, et al.TK-MH100 × 4-Luc (containing the UAS enhancer), and (c) Renilla luciferase control plasmid (pRL, cat. no. E2231; Promega); [MIX2]: (a) CMX-Gal4-hPPARγ, (b) TK-MH100 × 4-Luc, and (c) Renilla luciferase (pRL); [MIX3]:

(8) YY1-induced upregulation of DLGAP5 promotes tumor progression in lung adenocarcinoma via Wnt/β-catenin/EMT pathwayJournal of Translational MedicineMay 28, 2026Jiahe Li, Hong Kuang, Jiayu Lu, Xiaokang Shen, Qiang Lu, Chunbao Zangluciferase plasmid together with 20 ng of pRL-SV40 Renilla luciferase plasmid (Promega, USA; Cat. No. E2231) as an internal control for transfection efficiency. Transfection was performed using Lipofectamine

(9) An aerosolized dual-action autotaxin inhibitor-PPARγ agonist for the treatment of pulmonary fibrosisCell Rep MedMay 19, 2026Alexios N. Matralis, Elli-Anna Stylianaki, Eleni M. Ladopoulou, Paraskevi Kanellopoulou, Stefanos Smyrniotis, Christiana Magkrioti, Konstantinos D. Papavasileiou, Sabine Willems, Juan Pablo Rincon Pabon, Dimitris Nastos, et al.pFA-CMV-hPPARδ-LBD,Rau et al.99,N/A Plasmid: pFR-Luc,Stratagene,Cat#219050 Plasmid: pRL-SV40,Promega,Cat#E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, GraphPad Prism version

(10) SIRT2 mediates integrated stress response by deacetylating and stabilizing 4E-BP1 to suppress translationEMBO ReportsMay 18, 2026Yanlin Zi, Jiaqi Zhao, Miao Wang, Dan Hou, Richard A Cerione, Hening LinAUA,This paper, pGL3-control-SIRT2-5’UTR (133–234) AUG to AUA,This paper, PRL-Renilla Vector,Promega,E2231 pcDNA3.1-4E-BP1-C-(K)-DYK,Genscript,OHu15712 pcDNA3.1-4E-BP1-C-(K)-DYK K to R/Q mutants,Genscript,customized pcDNA3-myc-CUL3,Addgene,19893 pcDNA-Flag-SIRT2-WT,This

(11) FOXP1 is differentially active during development of murine vasopressin and oxytocin magnocellular neuronsiScienceMay 15, 2026Jari B. Berkhout, Sophie Trender, Quirin Krabichler, Yuval Podpecan, Felix Franke, Tim Schubert, Peter Burbach, Valery Grinevich, Roger Adan, Henning Fröhlich, et al.al.64,Addgene #153145 Flag-FOXP2 (pFOXP2),Moparthi et al.64,Addgene #153146 pRL-Renilla (pRL),Promega,Cat #E2231 pcDNA3.1(+),Thermo Fisher,Cat #V79020 ,, Software and algorithms,Software and algorithms,Software

(12) Blocking mitochondrial leucine transamination enhances T-cell activation and improves T-cell immunity against OVA-producing EL4 lymphomaBritish Journal of CancerMay 5, 2026Christie M. Adam, Tanner J. Wetzel, Sheila C. Erfan, Leighton M. Wheeler, Emily E. Baer, Lindsey P. Croll, Alexander M. Martin, Taha Z. Khan, Max L. Swain, Michael P. Boyer, et al.106/reaction) were transfected with 0.4 μg pRL Renilla luciferase vector (Promega, Madison, WI, Cat # E2231), via electroporation (Bio-Rad Gene Pulser, Bio-Rad, Hercules, CA), prior to co-culturing with expanded

(13) A microRNA expression signature in infant t(4;11) KMT2A::AFF1+ BCP-ALL uncovers novel therapeutic targetsHemasphereApril 23, 2026Camille Malouf, Alasdair Duguid, Kirsten S. Vrenken, Tom Leah, Ragini Medhi, Giuseppina Camiolo, Leslie Nitsche, Hélène Jakobczyk, Rishi S. Kotecha, Richard A. Anderson, et al.each well consisted of 98 ng of the pGL3‐promoter, 100 ng of pMIRH, and 2 ng of pRL‐SV40 (Promega Cat# E2231) in 100 µL of serum‐free DMEM and 1 mg/mL of polyethyleneimine, high molecular weight (Sigma‐Aldrich

(14) A Novel Mechanism for Depot-Specific Leptin Gene Expression Regulation and its Persistence After Weight LossiScienceApril 17, 2026Natalie Taege, Jan Hendric Britsemmer, Andreas Israel, Christin Krause, Sina Junge, Annette Feuchtinger, Siegfried Ussar, Paul Thomas Pfluger, Timo Gemoll, Sonja Charlotte Schriever, et al.US",CATGGTGTTAGGACACCGCTGTGGGAAAAACCGCTGGTCACGATGATGCCAGAA pRL-SV40 (Renilla SC40 plasmid),"Promega, US",E2231 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, CpG-free plasmid pCpGL-CMV,44,N/A Luci-RS1-CpGfree,created

(15) African swine fever virus pE199L, as a mitophagy receptor, suppresses antiviral innate immunity to promote viral replicationAutophagyApril 11, 2026Xiaoxuan Li, Binbin Ren, Danyang Zhang, Miao Dan, Dongying Liu, Ziwei Zhang, Jiakai Zhao, Yuchen Nan, Julian A. Hiscox, James P. Stewart, et al.(IFN-Beta_pGL3) was obtained from Addgene (102597; deposited by Nicolas Manel). The pRL-TK plasmid (Promega, E2231), which expresses Renilla luciferase, was used as an internal control for normalization in dual-luciferase

(16) HSPA6 Promotes Ferroptosis in Triple-Negative Breast Cancer by Rewiring Lipid Metabolism to Potentiate Membrane Lipid PeroxidationInternational Journal of Biological SciencesApril 8, 2026Lin-Yue Hai, Zhi-Hao Yu, Wen-Bo Liu, Yuan-Yuan Zhang, Yue Xu, Shan Cheng, Hao-Ran Yue, Zhang-Yin Guo, Shi-Jie Yan, Rui Sun, et al.μg of experimental plasmid, 10 ng pRL-SV40 of Renilla luciferase internal control plasmid (Promega, E2231), and pcDNA3.1 empty vector to maintain 4 μg total DNA. After 48 h, cells were lysed in 300 μL Passive

(17) GV1001 Reprograms CD47 Immune Checkpoint to Restore Macrophage Antitumor Activity in Oral Squamous Cell CarcinomaInt J Mol SciApril 7, 2026Wei Chen, Seojin Kim, Cheyenne Beheshtian, Angela Jun, Sangjae Kim, No-Hee Park(Thermo Fisher Scientific, cat. no. 11668), together with 50 ng of the pRL-SV40 vector (Promega, cat. no. E2231, Madison, WI, USA) encoding renilla luciferase as an internal control. Cell lysates were harvested,

(18) Cerebrospinal Fluid from Restless Legs Syndrome Patients Reduces Iron Uptake in Blood–Brain Barrier Endothelial Cells by Disrupting the Regulation of Transferrin ReceptorsAnnals of NeurologyApril 7, 2026Kondaiah Palsa, Aurosman Pappus Sahu, David B. Rye, Lynn Marie Trotti, Irina A. Elcheva, Vladimir S. Spiegelman, James R. ConnorDharmacon, (CN‐0010000‐01‐05), and 200ng of control vector of pRL Renilla Luciferase (Promega, USA, E2231). A dual luciferase assay (Promega) was performed 48 hours after co‐transfection. For CSF luciferase

(19) Primary ciliogenesis is promoted during epithelial-mesenchymal transition via a miR-200 – DZIP1 axisCell Communication and SignalingApril 1, 2026Laura Sourdin, Julie M. Bracken, Katherine A. Pillman, Andrew G. Bert, Yeesim Khew Goodall, Philip A. Gregory, Gregory J. Goodall, Cameron P. Bracken(Thermo Fisher Scientific, #13778075). For luciferase assays, 20 ng pRL and 10ng pGL3basic (Promega, #212936 and #E2231) were co-transfected with miRNA mimics (Thermo Fisher Scientific, Supplementary Table 4) into 24 well

(20) ELF3 drives glioblastoma multiforme progression through the regulation of MXRA8 expressionScientific ReportsApril 1, 2026Maomao Wang, Haiji Bo, Dapeng Chen, Jiangxin Mao, Zong Miao, Laixing WangMXRA8-MT constructs (200 ng) along with a Renilla luciferase plasmid (50 ng, internal control; Promega, #E2231) using Lipofectamine 3000. To investigate the role of ELF3, cells were also co-transfected with either

Be the First to Write a Review!

pRL-SV40 Vector

pRL-SV40 Vector from Promega

Description

Specifications/Features

Promega

Citations (323)

Reviews

pRL-SV40 Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map