pRL-SV40 Vector from Promega

Product Specs
ItempRL-SV40 Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2231
HostMammalian
ResistanceAmpR
PromoterSV40 early enhancer/promoter
Vector NamepRL-SV40
Quantity20microg
ReporterRenilla luciferase
Molecular Weight~73kDa
Selectable MarkerAmpicillin

Specifications/Features

Vector Size:
3705 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) FoxO transcription factors coordinate the urea cycle and gluconeogenesis by controlling Ass1iScienceSeptember 18, 2026Samia Karkoutly, Yoshinori Takeuchi, Zahra Mehrazad Saber, Duhan Tao, Tsolmon Mendsaikhan, Rika Saikawa, Yuichi Aita, Yuki Murayama, Akito Shikama, Yukari Masuda, et al.fragments Fr1, Fr2, Fr3, Fr1A, Fr1B, and mutated versions)",This paper,N/A Plasmid: pRL-SV40,Promega,Cat#E2231 Plasmid: FoxO1 expression vector,Yahagi et al.55,N/A Plasmid: FoxO3a expression vector,Yahagi et al.55,N/A Plasmid:

(2) Regulatory mechanisms of maternal imprinting at the murine Dlk1-Dio3 domainNat CommunSeptember 2, 2026Ariella Weinberg-Shukron, Frances L. Dearden, Ana Moreno-Barriga, Lok Ting Nick New, Marco Müller, Rebecca C. Rancourt, Carol A. Edwards, Anne C. Ferguson-Smithpositive control (pGL3-Control, Promega #E1741), a negative control (pRL-SV40 Renilla only, Promega #E2231), and an empty vector. Dual-Luciferase® reporter assay system The Dual-Luciferase® Reporter (DLRTM)

(3) RAGE phosphorylation by CK2 in human epithelial cell model: Modulation of connexin 43 expressioniScienceAugust 21, 2026Karen Coste, Anne-Marie Hesse, Geoffroy Marceau, Odile Filhol, Claude Cochet, Céline Freton, Loïc Blanchon, Vincent Sapin, Corinne BelvilleTransduction Pathway cis-Reporting System),Agilent,Cat#219077 pRL-TK Renilla luciferase plasmid,Promega,Cat#E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, LightCycler® 480 Software

(4) The DLX/Notch axis is necessary for spatiotemporal regulation of neural cell fateNature CommunicationsAugust 20, 2026Ryan F. Leung, Michael See, Ankita M. George, Patrick L. Barry, Kyle A. France, Natalie Charitakis, Mirana Ramialison, Maree C. Faux, David D. EisenstatpGL3_Dll1, pGL3_Ascl1) (10 ng), pcDNA3 vectors (pcDNA3, pcDNA3_DLX2) (20 ng), pRL (0.5 ng) (Promega Cat# E2231) and FuGENE transfection reagent at a ratio of 3 µL per µg of DNA (Promega Cat# E2311) were added to

(5) Autoantibodies against type I interferons in patients with zoonotic H7N9 influenza: an observational case-control studyEBioMedicineJuly 16, 2026Yongkun Chen, Jakob Ankerhold, Tingting Jia, Martin Wolkewitz, Jonas Fuchs, Lifang Yuan, Tian Bai, Kevin Groen, Roger Kuratli, Benjamin G. Hale, et al.control of five copies of the IFN-stimulated response element (ISRE) promoter, 4 ng of pRL-SV40 (Promega, E2231), constitutively expressing Renilla luciferase to normalise transfection efficiency, and 20 ng of empty

(6) Identification and functional characterization of regulatory variants in DPP9 associated with COVID-19 severityGenome MedicineJuly 2, 2026Gaëlle Farah, Magali Torres, Leo Henches, Hugues Aschard, Jade Ghosn, Xavier Duval, Milieu Intérieur Consortium, Laurent Abel, Andres Alcover, Philippe Bousso, et al.Jurkat cells were co-transfected with 200 ng of pRL-SV40 (a plasmid encoding Renilla luciferase) (Promega, E2231), and either 1µg of constructs of interest or 1 µg of control vectors using the Neon™ Transfection System

(7) Smad2 Preserves Corneal Stromal Homeostasis by Restraining Profibrotic Smad3/YAP/TEAD2 Transcriptional ProgramCellsJuly 2, 2026Ruimei Zhou, Dunpeng Cai, Shi-You Chenreporters and a constitutive Renilla luciferase internal control (pRL-TK, Promega, Madison, WI, USA, #E2231) using Lipofectamine 3000. The reporters used were SBE4-Luc (Addgene plasmid, #16495, a Smad3/4-responsive

(8) Cerebellar microRNA-206 tunes Purkinje neuron firing dynamics to control sensorimotor gatingbioRxivJune 30, 2026Mary P. Heyer, Masago Ishikawa, Junshi Wang, John Erol Evangelista, Amanda K. Fakira, Avi Ma'ayan, Guoping Feng, Paul J. Kenny(firefly-luciferase),"Lu et al., 2007",N/A pcDNA3.1(+)-luc-miR-206-sensor,This paper,N/A pRL-SV40,Promega,E2231 "pEMS-2115 (AAV2, Ple155!Pcp2-emGFP-WPRE)","Korecki et al., 2021",Addgene plasmid #49140 RRID:Addgene_49140 pAAV-Pcp2-MCS-emGFP,This

(9) ZEB1 drives terminal erythroid maturation by controlling the GATA2-KLF1 regulatory switchNucleic Acids ResJune 23, 2026Alexia Kinoo, Virginie Deleuze, Mohammad Salma, Noémie Legoff, Jérémie Candotti, Pedro Gonzalez-Menendez, Axel Joly, Jérémy Galtier, Julie Charmeaux-Goulot, Sanjay Chahar, et al.GATA2 enhancer were transfected in HEK293T cells together with expression plasmids and pRL-TK (cat# E2231, Promega) for internal normalization. Cell lysates were prepared and Firefly and Renilla luciferase

(10) RBM12 Maintains Glioma Stem Cells by Activating Amino Acid‐Dependent mTORC1 Signaling via SLC7A5 mRNA StabilizationAdvanced ScienceJune 22, 2026Hong Lei, Wenlong Luo, Shu Zhou, Lihao Wan, Peng Ling, Zhihua Huang, Zhihua Qian, Chenfei Lu, Mengyue Guo, Zhen Xue, et al.were co‐transfected with corresponding plasmids and the pRL internal control vector (Promega, Cat# E2231). To ensure equal amounts of DNA in all transfection combinations, the appropriate control vector was

(11) EBF1 Deficiency Drives Prostate Cancer Progression by Interfering with the Transcriptional Regulation of ITPR1Oncology ResearchJune 16, 2026Yuan Guo, Hui Wang, Xiaoyu Zhao, Xiao Feng, Xingjian Cai, Wei Li, Xiaohui Luoor mutant reporter plasmids and 0.02 μg pRL-TK Renilla reporter plasmids (Promega, Beijing, China, #E2231) were cotransfected into EBF1-null 293T cells (Applied Biological Materials, #T3005391), along with

(12) Bacteroides-derived endocannabinoid-like commendamide attenuates skeletal muscle ferroptosis in vitro: implications for Duchenne muscular dystrophyJournal of Translational MedicineJune 6, 2026Noemi Di Muraglia, Martina De Vito, Elisabetta Panza, Ester Pagano, Rosa Maria Vitale, Fabiana Piscitelli, Rosaria Villano, Raffaele Capasso, Vincenzo Pota, Caterina Pace, et al.TK-MH100 × 4-Luc (containing the UAS enhancer), and (c) Renilla luciferase control plasmid (pRL, cat. no. E2231; Promega); [MIX2]: (a) CMX-Gal4-hPPARγ, (b) TK-MH100 × 4-Luc, and (c) Renilla luciferase (pRL); [MIX3]:

(13) YY1-induced upregulation of DLGAP5 promotes tumor progression in lung adenocarcinoma via Wnt/β-catenin/EMT pathwayJournal of Translational MedicineMay 28, 2026Jiahe Li, Hong Kuang, Jiayu Lu, Xiaokang Shen, Qiang Lu, Chunbao Zangluciferase plasmid together with 20 ng of pRL-SV40 Renilla luciferase plasmid (Promega, USA; Cat. No. E2231) as an internal control for transfection efficiency. Transfection was performed using Lipofectamine

(14) An aerosolized dual-action autotaxin inhibitor-PPARγ agonist for the treatment of pulmonary fibrosisCell reports. MedicineMay 19, 2026Matralis AN, Stylianaki EA, Ladopoulou EM, Kanellopoulou P, Smyrniotis S, Magkrioti C, Papavasileiou KD, Willems S, Rincon Pabon JP, Nastos D, et al.pFA-CMV-hPPARδ-LBD,Rau et al.99,N/A Plasmid: pFR-Luc,Stratagene,Cat#219050 Plasmid: pRL-SV40,Promega,Cat#E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, GraphPad Prism version

(15) SIRT2 mediates integrated stress response by deacetylating and stabilizing 4E-BP1 to suppress translationEMBO ReportsMay 18, 2026Yanlin Zi, Jiaqi Zhao, Miao Wang, Dan Hou, Richard A Cerione, Hening LinAUA,This paper, pGL3-control-SIRT2-5’UTR (133–234) AUG to AUA,This paper, PRL-Renilla Vector,Promega,E2231 pcDNA3.1-4E-BP1-C-(K)-DYK,Genscript,OHu15712 pcDNA3.1-4E-BP1-C-(K)-DYK K to R/Q mutants,Genscript,customized pcDNA3-myc-CUL3,Addgene,19893 pcDNA-Flag-SIRT2-WT,This

(16) FOXP1 is differentially active during development of murine vasopressin and oxytocin magnocellular neuronsiScienceMay 15, 2026Berkhout JB, Trender S, Krabichler Q, Podpecan Y, Franke F, Schubert T, Burbach P, Grinevich V, Adan R, Fröhlich H, et al.al.64,Addgene #153145 Flag-FOXP2 (pFOXP2),Moparthi et al.64,Addgene #153146 pRL-Renilla (pRL),Promega,Cat #E2231 pcDNA3.1(+),Thermo Fisher,Cat #V79020 ,, Software and algorithms,Software and algorithms,Software

(17) Blocking mitochondrial leucine transamination enhances T-cell activation and improves T-cell immunity against OVA-producing EL4 lymphomaBritish Journal of CancerMay 5, 2026Christie M. Adam, Tanner J. Wetzel, Sheila C. Erfan, Leighton M. Wheeler, Emily E. Baer, Lindsey P. Croll, Alexander M. Martin, Taha Z. Khan, Max L. Swain, Michael P. Boyer, et al.106/reaction) were transfected with 0.4 μg pRL Renilla luciferase vector (Promega, Madison, WI, Cat # E2231), via electroporation (Bio-Rad Gene Pulser, Bio-Rad, Hercules, CA), prior to co-culturing with expanded

(18) A microRNA expression signature in infant t(4;11) KMT2A::AFF1+ BCP-ALL uncovers novel therapeutic targetsHemasphereApril 23, 2026Camille Malouf, Alasdair Duguid, Kirsten S. Vrenken, Tom Leah, Ragini Medhi, Giuseppina Camiolo, Leslie Nitsche, Hélène Jakobczyk, Rishi S. Kotecha, Richard A. Anderson, et al.each well consisted of 98 ng of the pGL3‐promoter, 100 ng of pMIRH, and 2 ng of pRL‐SV40 (Promega Cat# E2231) in 100 µL of serum‐free DMEM and 1 mg/mL of polyethyleneimine, high molecular weight (Sigma‐Aldrich

(19) A Novel Mechanism for Depot-Specific Leptin Gene Expression Regulation and its Persistence After Weight LossiScienceApril 17, 2026Natalie Taege, Jan Hendric Britsemmer, Andreas Israel, Christin Krause, Sina Junge, Annette Feuchtinger, Siegfried Ussar, Paul Thomas Pfluger, Timo Gemoll, Sonja Charlotte Schriever, et al.US",CATGGTGTTAGGACACCGCTGTGGGAAAAACCGCTGGTCACGATGATGCCAGAA pRL-SV40 (Renilla SC40 plasmid),"Promega, US",E2231 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, CpG-free plasmid pCpGL-CMV,44,N/A Luci-RS1-CpGfree,created

(20) African swine fever virus pE199L, as a mitophagy receptor, suppresses antiviral innate immunity to promote viral replicationAutophagyApril 11, 2026Xiaoxuan Li, Binbin Ren, Danyang Zhang, Miao Dan, Dongying Liu, Ziwei Zhang, Jiakai Zhao, Yuchen Nan, Julian A. Hiscox, James P. Stewart, et al.(IFN-Beta_pGL3) was obtained from Addgene (102597; deposited by Nicolas Manel). The pRL-TK plasmid (Promega, E2231), which expresses Renilla luciferase, was used as an internal control for normalization in dual-luciferase

Be the First to Write a Review!

pRL-SV40 Vector

pRL-SV40 Vector from Promega

Description

Specifications/Features

Promega

Citations (329)

Reviews

pRL-SV40 Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map