pRL-SV40 Vector from Promega

Product Specs
ItempRL-SV40 Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2231
Quantity20microg
ResistanceAmpR
PromoterSV40 early enhancer/promoter
Vector NamepRL-SV40
Selectable MarkerAmpicillin
HostMammalian
ReporterRenilla luciferase
Molecular Weight~73kDa

Specifications/Features

Vector Size:
3705 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(21) Impaired cAMP-PKA-CREB1 signalling drives mitochondrial dysfunction in skeletal muscle during cancer cachexiaNature metabolismDecember 1, 2025Angelino E, Bodo L, Sartori R, Malacarne V, D'Anna B, Formaggio N, Barua S, Raiteri T, Lauria A, Reano S, et al.(pGL4.32[luc2P/NF-kB-RE/Hygro]; Promega; E8491) and pRL-null Vector (Renilla Luciferase Control Reporter Vector) (Promega; E2231), with a 10:1 ratio (luc/renilla). For transfection, ViaFect transfection reagent (Promega; E4982) was

(22) Neuroprotective effects of hyperbaric oxygen therapy on vascular cognitive impairment in hypoperfused mice via miR-137-3p/TRAF3 pathwayTranslational PsychiatryNovember 29, 2025Lu Yang, Hou-Ze Zhu, Liang Xie, Jun Yang, Hai-Tang Wei, Qun-Tao Yu, Hao Li, Ming Yang, Zhe LiChina).Firefly-tagged pGL3 promoter luciferase vector (#E1761) and the Renilla control luciferase vector (#E2231) were obtained from Promega Co.(WI,USA). Virus overexpressing TRAF3 (#MCP296365) and control virus were

(23) A non-coding ABO regulatory variant associatedwith VWF levels, thrombosis risk, and COVID-19 severity is topologically linked to ADAMTS13 in endothelial cellsHuman Genetics and Genomics AdvancesNovember 27, 2025Douglas Victorino Esposito, Hellen Ferreira de Souza Ferreira de Souza Sobrinho, Marcelo Rocha Marquesmedium was replaced. All wells were co-transfected with the pRL-SV40 plasmid (Promega, catalog no. E2231) to normalize luminescence readings. Cells were transfected with 100 ng plasmid containing one of the

(24) Activation of WDHD1 by DNA demethylases promotes MINPP1 transcription and glycolysis in lung adenocarcinoma progressionRespiratory ResearchNovember 25, 2025Guibin Zhao, Haiyan Liu, Daolin Ji, Xiao Ma, Gang TanWatertown, MA, USA) between the SacI and HindIII sites. pRL Renilla Luciferase Control Reporter Vectors (E2231, Promega Corporation, Madison, WI, USA) were used as a control. A549 and PC-9 cells (2 × 104 cells/well)

(25) Translational readthrough therapy for ADPKD induces polycystin1 expression and partially rescues functional deficits in PKD1 mutant cellsScientific ReportsNovember 22, 2025Elena Torban, Lucie Canaff, Sima Babayeva, Nadezda Kachurina, Chen-Fang Chung, Albert C. M. Ong, Ahsan Alam, Paul R. Goodyer(Addgene plasmid # 26280); Renilla Luciferase (R-Luc vector driven by the SV40 promoter, Promega, Car# E2231). Cell culture and transfection All experiments with human cells were covered by the Research Institute

(26) A combined genomic arrhythmia propensity score delineates cumulative riskCell Reports MedicineNovember 18, 2025Tanner O. Monroe, Megan J. Puckelwartz, Lorenzo L. Pesce, Samuel D. Kearns, Patrick Page, Nora Ibrahim, Zachary T. Weber, Emmanuel I. Ugwor, Marcelo A. Nóbrega, Prince Kannankeril, et al.pGL4.23-GW,Pasquali et al.121,Addgene plasmid #60323 pRL-SV40 Renilla luciferase plasmid,Promega,cat# E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, DRAGEN fastQC v0.11.9,Illumina,https://support.illumina.com/content/dam/illumina-support/help/Illumina_DRAGEN_Bio_IT_Platform_v3_7_1000000141465/Content/SW/Informatics/Dragen/FASTQC_Intro_fDG.htm Burrows-Wheeler

(27) Haplotype-resolved genomics identifies cyp19a1a as a candidate master sex-determining gene in golden trevally (Gnathanodon speciosus)iScienceOctober 17, 2025Bin Fan, Jiamin Guo, Caixia Lei, Sen Yang, Zining Meng, Junyao Peng, Yongjian Yang, Yubang Shen, Yuanyou Li, Le WangKit,Sangon Biotech,Cat#B110022-0002 pGL3-Basic plasmid,Promega,Cat#E1751 pRL Renilla plasmid,Promega,Cat#E2231 Lipofectamine 3000,Thermo Fisher,Cat#L3000015 TRIzol™ Reagent,Thermo Fisher,Cat#15596018 PCR master

(28) ZNF184-mediated transcriptional activation of SAE1 drives the cell cycle entry and immune evasion in non-small cell lung cancerRespiratory ResearchSeptember 29, 2025Feng Shi, Luquan Zhang, Chunli Wang, Qingwei Mengusing Lipofectamine 3000 (Thermo Fisher) with 10 ng of pRL Renilla Luciferase Control Reporter Vectors (E2231, Promega Corporation, Madison, WI, USA). After 48 h of transfection, luciferase activity was detected

(29) Heterozygous TBX2 frameshift variants cause a novel syndromic hearing loss with incompletely penetrant nystagmusJ Med GenetSeptember 17, 2025Wan Hua, Yanfei Wang, Xiang Li, Wenyu Xiong, Lanchen Wang, Meilin Chen, Fengxiao Bu, Libo Liu, Fangyi Chen, Mingjun Zhong, et al.Promega) that contained four palindromic T-box binding site sequences (AATTTCACACCTAGGTGTGAAATT), pRL-TK (E2231, Promega) was used as the internal reference reporter plasmid. Transcriptional activity assay was performed

(30) Procollagen IIA mediates positive feedback control of the mouse cardiogenic transcriptional networkProceedings of the National Academy of SciencesSeptember 9, 2025Alan W. Leung, Sandra Y. Wong, Janet C. Zhang, Keith K. H. Leung, Nelson W. F. Dung, Catherine A. Shang, Owen W. Prall, Hieu T. Nim, Michael See, Mirana Ramialison, et al.reporter driven by a GC-rich sequence in the Smad6 promoter (43), Renilla-luciferase plasmid (Promega #E2231), with or without pRc/CMV-IIA, pRc/CMV-IIB, or pRc/CMV-NpIIA expression vectors, were cotransfected

(31) Adaptive PRKAA1 variant in Andeans is associated with improved ventilation and sleep phenotypesiScienceAugust 15, 2025Elijah S. Lawrence, Wanjun Gu, Mitchell C. Kong, Santiago Fassardi, Cecilia Anza-Ramirez, Esteban A. Moya, Erica C. Heinrich, James J. Yu, Jeremy E. Orr, Steven Y. Cao, et al.promoter,Genewiz,N/A pGL3-Basic vector,Promega,Cat#E1761 pRL-SV40 Renilla Luciferase Control Vector,Promega,Cat#E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, Composite of Multiople

(32) Interplay of YEATS2 and GCDH regulates histone crotonylation and drives EMT in head and neck cancerElifeAugust 14, 2025Deepak Pant, Parik Kakani, Rushikesh Joshi, Abin Sabu, Shruti Agrawal, Atul Samaiya, Sanjeev ShuklaYEATS2-promoter deletion wild-type constructs or SP1-site mutated constructs and pRL-TK Renilla (Promega, E2231) luciferase plasmid. After 24 hr of transfection, cells were lysed using passive lysis buffer (1% Triton

(33) CircMORC1 downregulated in plasma EVs promotes gastric cancer cell proliferation and invasion via miR-103a-1-5p spongingBMC CancerAugust 13, 2025Xiang-Ming Zhai, Yi-Qi Yang, Li Lin, Huan-Chang Luo, Zhi-Wei Guo, Ying-Song Wuplasmid, miR-103a-1-5p or NC mimic, and pRL-TK Renilla luciferase control reporter vector (Promega, #E2231) using Lipofectamine 2000. After transfection for 48 h, a Dual-Lumi™ Luciferase Reporter Gene Assay

(34) Copy number amplification of TTPAL promotes cholesterol biosynthesis and esophageal squamous cell carcinoma progression via elevating NSUN2-mediated m5C modification of SREBP2 mRNAJ Exp Clin Cancer ResJuly 26, 2025Shan Huang, Yuanyuan Liu, Manyu Zhao, Tao Wang, Lihua Mao, Ting Wang, Chunyuan Guo, Wentao Huang, Zimei Peng, Zhen Zhang, et al.ng of pmirGLO constructs were co-transfected with 50 ng pRL-SV40 Renilla normalization vector (Cat# E2231, Promega) into ESCC cells (cultured in 24-well plates) using Lipofectamine 3000 reagent with parallel

(35) The EIF4EBP1 gene encoding 4EBP1 is transcriptionally upregulated by MYC and linked to shorter survival in medulloblastomaCell Death DiscovJuly 16, 2025Laura Hruby, Katerina Schaal, Alberto Delaidelli, Daniel Picard, Christopher Dunham, Oksana Lewandowska, Tobias Reiff, Magalie Larcher, Celio Pouponnot, Poul Hb Sorensen, et al.luciferase plasmid (wild type or mutants), 2 ng of Renilla luciferase expressing pRL SV40 plasmid (E2231, Promega; Madison, Wisconsin; USA), as internal control, and 25 ng, 50 ng or 100 ng of MYC expressing

(36) Unraveling an enhancer-silencer regulatory element showing epistatic interaction with a variant that escaped genome-wide association studiesCell GenomicsJuly 9, 2025Mathieu Adjemout, Samia Nisar, Amélie Escandell, Romain Torres, Magali Torres, Hong Thu Nguyen Huu, Alassane Thiam, Iris Manosalva, Babacar Mbengue, Alioune Dieye, et al.rs11240391-G allele) and (2) 200 ng of pRL-SV40 (plasmid encoding renilla luciferase from Promega (Cat#E2231)), as an internal control for transfection efficiency. After transfection, Jurkat cells were rested

(37) Landscape of cancer associated EpCAM mutations: molecular modeling, predictive insights and impact on patient survivalBMC CancerJuly 1, 2025Priyanka S. Dhotare, Audrey C. Bochi-Layec, Timothy P. Fleming, William E. Gillanders, Ross M. Bremner, Kailas D. Sonawane, Narendra V. Sankpal400 ng-SRE-Luc (Promega# E1340) together with internal control plasmid 50 ng-pRLSV40-Luc (Promega# E2231) was transfected using FuGENE-HD (Promega # E2311). After 12 h post transfection cells were serum-starved

(38) Landscape of cancer associated EpCAM mutations: molecular modeling, predictive insights and impact on patient survivalBMC CancerJuly 1, 2025Priyanka S. Dhotare, Audrey C. Bochi-Layec, Timothy P. Fleming, William E. Gillanders, Ross M. Bremner, Kailas D. Sonawane, Narendra V. Sankpal400 ng-SRE-Luc (Promega# E1340) together with internal control plasmid 50 ng-pRLSV40-Luc (Promega# E2231) was transfected using FuGENE-HD (Promega # E2311). After 12 h post transfection cells were serum-starved

(39) FRRS1L variants and ferriheme overload drive hyperpigmentation and systemic Iron overload in lanping black bone sheepCell BiosciJune 24, 2025Deping Han, Yuanyuan Zhang, Weidong Deng, Xue Yang, Jianfei Chen, Guoying Hua, Hesham Y.A. Darwish, Huaming Mao, Xiao Gou, Jiankui Wang, et al.China). Each construct included six biological replicates, with the psiCHECK2 vector and pRL-SV40 (E2231, Promega Biotech Co., Ltd., Beijing, China) as a blank control. After 36 h, firefly and renilla luciferase

(40) Host susceptibilities and entry processes of SARS-CoV-2 Omicron variants using pseudotyped viruses carrying spike proteinBMC Vet ResMay 27, 2025Alexandria Zabiegala, Yunjeong Kim, Kyeong-Ok Changor without pCMV6-hTMPRSS2 (#RC208677, Origene). The plasmid expressing Renilla luciferase, pRL-CMV (#E2231, Promega), was included as an expression control. The firefly luciferase activity was normalized to

Be the First to Write a Review!

pRL-SV40 Vector

pRL-SV40 Vector from Promega

Description

Specifications/Features

Promega

Citations (311)

Reviews

pRL-SV40 Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map