pRL-SV40 Vector from Promega

Product Specs
ItempRL-SV40 Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2231
HostMammalian
ResistanceAmpR
PromoterSV40 early enhancer/promoter
Vector NamepRL-SV40
Quantity20microg
ReporterRenilla luciferase
Molecular Weight~73kDa
Selectable MarkerAmpicillin

Specifications/Features

Vector Size:
3705 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(41) Heterozygous TBX2 frameshift variants cause a novel syndromic hearing loss with incompletely penetrant nystagmusJ Med GenetSeptember 17, 2025Wan Hua, Yanfei Wang, Xiang Li, Wenyu Xiong, Lanchen Wang, Meilin Chen, Fengxiao Bu, Libo Liu, Fangyi Chen, Mingjun Zhong, et al.Promega) that contained four palindromic T-box binding site sequences (AATTTCACACCTAGGTGTGAAATT), pRL-TK (E2231, Promega) was used as the internal reference reporter plasmid. Transcriptional activity assay was performed

(42) Procollagen IIA mediates positive feedback control of the mouse cardiogenic transcriptional networkProceedings of the National Academy of SciencesSeptember 9, 2025Alan W. Leung, Sandra Y. Wong, Janet C. Zhang, Keith K. H. Leung, Nelson W. F. Dung, Catherine A. Shang, Owen W. Prall, Hieu T. Nim, Michael See, Mirana Ramialison, et al.reporter driven by a GC-rich sequence in the Smad6 promoter (43), Renilla-luciferase plasmid (Promega #E2231), with or without pRc/CMV-IIA, pRc/CMV-IIB, or pRc/CMV-NpIIA expression vectors, were cotransfected

(43) Adaptive PRKAA1 variant in Andeans is associated with improved ventilation and sleep phenotypesiScienceAugust 15, 2025Elijah S. Lawrence, Wanjun Gu, Mitchell C. Kong, Santiago Fassardi, Cecilia Anza-Ramirez, Esteban A. Moya, Erica C. Heinrich, James J. Yu, Jeremy E. Orr, Steven Y. Cao, et al.promoter,Genewiz,N/A pGL3-Basic vector,Promega,Cat#E1761 pRL-SV40 Renilla Luciferase Control Vector,Promega,Cat#E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, Composite of Multiople

(44) Interplay of YEATS2 and GCDH regulates histone crotonylation and drives EMT in head and neck cancerElifeAugust 14, 2025Deepak Pant, Parik Kakani, Rushikesh Joshi, Abin Sabu, Shruti Agrawal, Atul Samaiya, Sanjeev ShuklaYEATS2-promoter deletion wild-type constructs or SP1-site mutated constructs and pRL-TK Renilla (Promega, E2231) luciferase plasmid. After 24 hr of transfection, cells were lysed using passive lysis buffer (1% Triton

(45) CircMORC1 downregulated in plasma EVs promotes gastric cancer cell proliferation and invasion via miR-103a-1-5p spongingBMC CancerAugust 13, 2025Xiang-Ming Zhai, Yi-Qi Yang, Li Lin, Huan-Chang Luo, Zhi-Wei Guo, Ying-Song Wuplasmid, miR-103a-1-5p or NC mimic, and pRL-TK Renilla luciferase control reporter vector (Promega, #E2231) using Lipofectamine 2000. After transfection for 48 h, a Dual-Lumi™ Luciferase Reporter Gene Assay

(46) Copy number amplification of TTPAL promotes cholesterol biosynthesis and esophageal squamous cell carcinoma progression via elevating NSUN2-mediated m5C modification of SREBP2 mRNAJ Exp Clin Cancer ResJuly 26, 2025Shan Huang, Yuanyuan Liu, Manyu Zhao, Tao Wang, Lihua Mao, Ting Wang, Chunyuan Guo, Wentao Huang, Zimei Peng, Zhen Zhang, et al.ng of pmirGLO constructs were co-transfected with 50 ng pRL-SV40 Renilla normalization vector (Cat# E2231, Promega) into ESCC cells (cultured in 24-well plates) using Lipofectamine 3000 reagent with parallel

(47) The EIF4EBP1 gene encoding 4EBP1 is transcriptionally upregulated by MYC and linked to shorter survival in medulloblastomaCell Death DiscovJuly 16, 2025Laura Hruby, Katerina Schaal, Alberto Delaidelli, Daniel Picard, Christopher Dunham, Oksana Lewandowska, Tobias Reiff, Magalie Larcher, Celio Pouponnot, Poul Hb Sorensen, et al.luciferase plasmid (wild type or mutants), 2 ng of Renilla luciferase expressing pRL SV40 plasmid (E2231, Promega; Madison, Wisconsin; USA), as internal control, and 25 ng, 50 ng or 100 ng of MYC expressing

(48) Unraveling an enhancer-silencer regulatory element showing epistatic interaction with a variant that escaped genome-wide association studiesCell GenomicsJuly 9, 2025Mathieu Adjemout, Samia Nisar, Amélie Escandell, Romain Torres, Magali Torres, Hong Thu Nguyen Huu, Alassane Thiam, Iris Manosalva, Babacar Mbengue, Alioune Dieye, et al.rs11240391-G allele) and (2) 200 ng of pRL-SV40 (plasmid encoding renilla luciferase from Promega (Cat#E2231)), as an internal control for transfection efficiency. After transfection, Jurkat cells were rested

(49) Landscape of cancer associated EpCAM mutations: molecular modeling, predictive insights and impact on patient survivalBMC CancerJuly 1, 2025Priyanka S. Dhotare, Audrey C. Bochi-Layec, Timothy P. Fleming, William E. Gillanders, Ross M. Bremner, Kailas D. Sonawane, Narendra V. Sankpal400 ng-SRE-Luc (Promega# E1340) together with internal control plasmid 50 ng-pRLSV40-Luc (Promega# E2231) was transfected using FuGENE-HD (Promega # E2311). After 12 h post transfection cells were serum-starved

(50) Landscape of cancer associated EpCAM mutations: molecular modeling, predictive insights and impact on patient survivalBMC CancerJuly 1, 2025Priyanka S. Dhotare, Audrey C. Bochi-Layec, Timothy P. Fleming, William E. Gillanders, Ross M. Bremner, Kailas D. Sonawane, Narendra V. Sankpal400 ng-SRE-Luc (Promega# E1340) together with internal control plasmid 50 ng-pRLSV40-Luc (Promega# E2231) was transfected using FuGENE-HD (Promega # E2311). After 12 h post transfection cells were serum-starved

(51) FRRS1L variants and ferriheme overload drive hyperpigmentation and systemic Iron overload in lanping black bone sheepCell BiosciJune 24, 2025Deping Han, Yuanyuan Zhang, Weidong Deng, Xue Yang, Jianfei Chen, Guoying Hua, Hesham Y.A. Darwish, Huaming Mao, Xiao Gou, Jiankui Wang, et al.China). Each construct included six biological replicates, with the psiCHECK2 vector and pRL-SV40 (E2231, Promega Biotech Co., Ltd., Beijing, China) as a blank control. After 36 h, firefly and renilla luciferase

(52) Host susceptibilities and entry processes of SARS-CoV-2 Omicron variants using pseudotyped viruses carrying spike proteinBMC Vet ResMay 27, 2025Alexandria Zabiegala, Yunjeong Kim, Kyeong-Ok Changor without pCMV6-hTMPRSS2 (#RC208677, Origene). The plasmid expressing Renilla luciferase, pRL-CMV (#E2231, Promega), was included as an expression control. The firefly luciferase activity was normalized to

(53) From Rare to Common: Genetic Insights into TLR7 Variants in a Multicentric Spanish Study on COVID-19 SeverityJ Clin ImmunolMay 27, 2025Arnau Antolí, Gardenia Vargas-Parra, Angels Sierra-Fortuny, Jose Luis Gomez-Vazquez, Paula Rofes, Elisabet Munté, Julen Viana-Errasti, Raúl Marín-Montes, Adriana López-Doriga, Lidia Feliubadaló, et al.vector (RC210505, OriGene), 0.625 ng/well; and a constitutively expressing Renilla luciferase plasmid (E2231, Promega), 10 ng/well. After 24h, cells were stimulated or not with various TLR7 agonists for 24h: R848

(54) Utility of the Base Editing System for Introducing Drug-Resistant Gene Mutations Into Human Leukemia Cellular ModelsCureusApril 8, 2025Thao Nguyen, Minori Tamai, Shinichi Fujisawa, Akiko Nagamachi, Keiko Kagami, Chiaki Komatsu, Shotaro Iwamoto, Toshiya Inaba, Takanori Teshima, Takeshi InukaipGL3-dRE vectors by applying lipofectamine 3000 (ThermoFisher Scientific L3000001). pTK-RL (Promega, E2231), a reporter plasmid of Renilla luciferase, was co-transfected for each transfection as internal control.

(55) Selective Activity of Chrysin-6-C-Fucopyranoside from Cyclanthera pedata Toward Peroxisome Proliferator-Activated Receptor GammaMoleculesApril 5, 2025Marco Zuccolo, Angela Bassoli, Gigliola Borgonovo, Luca Giupponi, Annamaria Giorgi, Aniello Schiano Moriello, Fabio Arturo Iannottiplasmids:CMX-Gal4-hPPARα;TK-MH100 × 4-Luc containing the UAS enhancer;Renilla Luciferase (pRL, Promega, Cat. E2231). Cells transfected with an equal amount of pcDNA3.1 Cat# V79020 (Life Technologies, Italy) were used

(56) Compound screening in human airway basal cells identifies Wnt pathway activators as potential pro-regenerative therapiesJournal of Cell ScienceApril 1, 2025Yuki Ishii, Jessica C. Orr, Marie-Belle El Mdawar, Denise R. Bairros de Pilger, David R. Pearce, Kyren A. Lazarus, Rebecca E. Graham, Marko Z. Nikolić, Robin Ketteler, Neil O. Carragher, et al.plates at 900,000 cells/well. The following day cells were co-transfected with the pRL SV40 construct (E2231, Promega) using jetOPTIMUS (101000051, Polyplus) along with either the M50 Super 8x TOPFlash (deposited

(57) A highland-adaptation variant near MCUR1 reduces its transcription and attenuates erythrogenesis in TibetansCell GenomMarch 12, 2025Ping J, Liu X, Lu Y, Quan C, Fan P, Lu H, Li Q, Wang C, Zhang Z, Liu M, et al.X-tremegene HP DNA Transfection Reagent (#6366244001; Roche, Basel, Switzerland). The pRL-SV40 plasmid (#E2231; Promega, WI, USA) was co-transfected as a negative control. After 48 h of incubation, the cells were

(58) Hypoxia-induced ATF3 escalates breast cancer invasion by increasing collagen deposition via P4HA1Cell Death DisFebruary 27, 2025Shruti Ganesh Dhamdhere, Anamika Bansal, Pranjal Singh, Parik Kakani, Shruti Agrawal, Atul Samaiya, Sanjeev Shuklapromoter-cloned Luciferase vectors were co-transfected with pRL-TK Renilla Luciferase plasmid (Promega, E2231). After 12 h the cells were supplemented with fresh media and subjected to hypoxic condition. After treatment

(59) HHV-6B ribonucleotide reductase sequesters NF-κB subunit p65 to inhibit innate immune responsesiScienceFebruary 21, 2025Mansaku Hirai, Khoir Amaliin, Jing Rin Huang, Salma Aktar, Yasuko Mori, Jun Ariial.,47",Addgene plasmid #74202 Plasmid: pGL4.32 (NF-κB-luc),Promega,Cat # E8491 Plasmid: pRL-SV40,Promega,Cat # E2231 Plasmid: pRL-TK,Promega,Cat # E2241 Plasmid: pTK-N-LgBiT,Promega,Cat # N2014 Plasmid: pTK-C-LgBiT,Promega,Cat

(60) A genome-wide association study identified PRKCB as a causal gene and therapeutic target for Mycobacterium avium complex diseaseCell Reports MedicineFebruary 18, 2025Ruijuan Zheng, Zhiqiang Li, Weijun Fang, Hai Lou, Feng Liu, Qin Sun, Xiang Shi, Hua Liu, Qing Chen, Xiaona Shen, et al.paper,N/A pGL3-promoter,Promega,E1751 pGL3-promoter-PRKCBWT,This paper,N/A pGL3-promoter-PRKCBMT,This paper,N/A pRL-TK Renilla,Promega,E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, ImageJ,National Institutes

Be the First to Write a Review!

pRL-SV40 Vector

pRL-SV40 Vector from Promega

Description

Specifications/Features

Promega

Citations (323)

Reviews

pRL-SV40 Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map