psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(301) Tumour-suppressive microRNA-144-5p directly targets CCNE1/2 as potential prognostic markers in bladder cancerBritish Journal of CancerJuly 14, 2015R Matsushita et al.between the XhoI and PmeI restriction sites in the 30 -UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). The procedure for dual-luciferase reporter assay was described previously

(302) Endogenous antiviral microRNAs determine permissiveness for hepatitis B virus replication in cultured human fetal and adult hepatocytesJournal of Medical VirologyJuly 1, 2015Mukesh Kumar, Yogeshwar Sharma, Sriram Bandi, Sanjeev Guptamin. The amplicon was sequence-verified and cloned into PmeI and NotI sites of psiCHECK™-2 vector (C8021, Promega, Madison, WI). This allowed SV40 promoter-regulated HBV transcription with Renilla luciferase

(303) The tumor-suppressive microRNA-1/133a cluster targets PDE7A and inhibits cancer cell migration and invasion in endometrial cancerInternational Journal of OncologyJuly 1, 2015NORIKO YAMAMOTO et al.inserted between the XhoI and PmeI restriction sites in the 3'UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). Hec265 cells were then transfected with 5 ng vector or 10 nM mature miRNA. Statistical

(304) Disruption of miR-29 Leads to Aberrant Differentiation of Smooth Muscle Cells Selectively Associated with Distal Lung VasculaturePLoS geneticsMay 1, 2015Cushing L, Costinean S, Xu W, Jiang Z, Madden L, Kuang P, Huang J, Weisman A, Hata A, Croce CM, et al.Renilla luciferase reporter gene in the psiCHECK2 dual luciferase reporter plasmid (Promega, Cat.# C8021). Nested primers (forward: 5’CTAAATGATAATAATTGGTGAGTCTTGGTTCTA 3’ and reverse: 5’GACTCACCAATTATTATCATTTAGGCTATTTAAA

(305) A Burst of miRNA Innovation in the Early Evolution of Butterflies and MothsMolecular Biology and EvolutionMay 1, 2015Shan Quah, Jerome H.L. Hui, Peter W.H. Hollandby restriction sites and inserted into the multiple cloning site of the psiCHECK-2 vector (Promega, C8021) downstream of the hRluc stop codon to make the psiCHECK-2:Ci-UTR construct. To generate a construct,

(306) hiCLIP reveals the in vivo atlas of mRNA secondary structures recognized by Staufen 1NatureMarch 26, 2015Sugimoto Y, Vigilante A, Darbo E, Zirra A, Militti C, D'Ambrogio A, Luscombe NM, Ule J.(CCGCTCGAGTTCGTTTTGACCACATATATACCAAG) and fX_pr2 (ATAGTTTAGCGGCCGCGATGCT GCATTGTACCTTTTAATTGC), and cloned into psiCHeck2 (Promega, C8021). The XBP1 mut and comp reporter (Fig. 4b) were generated from the XBP1 wt construct using fX_pr3 (GCTAGTGTAGCTTCTGAAAGGTGaaCTTTCTCCATTTATTTAAAACTACCC)

(307) Stereochemical bias introduced during RNA synthesis modulates the activity of phosphorothioate siRNAsNature communicationsMarch 6, 2015Jahns H, Roos M, Imig J, Baumann F, Wang Y, Gilmour R, Hall J.according to the manufacturer's instructions. Reporter plasmid preparation and sequences PsiCHECK2 (no. C8021, Promega, Dübendorf, CH) dual luciferase reporter plasmids were cut with Not1 and Xho1 restriction enzymes,

(308) Profiling of MicroRNAs Involved in Retinal Degeneration Caused by Selective Müller Cell AblationPLOS ONEMarch 5, 2015Sook Hyun Chung, Mark Gillies, Yuki Sugiyama, Ling Zhu, So-Ra Lee, Weiyong Shenlocated downstream of the renilla translational stop codon within the psiCHECKTM-2 vector (Promega, C8021). 661w photoreceptor cells were seeded in 12-well plates (50,000 cells per well) and cultured for 2

(309) MicroRNA expression signature of oral squamous cell carcinoma: functional role of microRNA-26a/b in the modulation of novel cancer pathwaysBritish journal of cancerMarch 3, 2015Fukumoto I, Hanazawa T, Kinoshita T, Kikkawa N, Koshizuka K, Goto Y, Nishikawa R, Chiyomaru T, Enokida H, Nakagawa M, et al.inserted between the Xhol-PmeI restriction sites in the 3′-UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). The procedure for the dual-luciferase reporter assay was described previously

(310) Tumor-suppressive microRNA-206 as a dual inhibitor of MET and EGFR oncogenic signaling in lung squamous cell carcinomaInternational Journal of OncologyMarch 1, 2015HIROKO MATAKI, NAOHIKO SEKI, TAKESHI CHIYOMARU, HIDEKI ENOKIDA, YUSUKE GOTO, TOMOHIRO KUMAMOTO, KENTARO MACHIDA, KEIKO MIZUNO, MASAYUKI NAKAGAWA, HIROMASA INOUEinserted between the XhoI‑PmeI restriction sites in the 3'-UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). Similarly, partial wild-type sequences of the EGFR 3'-UTR or those with

(311) microRNA-195 functions as a tumor suppressor by inhibiting CBX4 in hepatocellular carcinomaOncology ReportsMarch 1, 2015CHANGLI ZHENG et al.Biotechnology (Shanghai, China). The pcDNA3.1 plasmid (Invitrogen, Carlsbad, CA, USA) and psiCHECK™-2 vector (C8021; Promega, San Luis Obispo, CA, USA) were purchased from Auragene Biotechnology (Changsha, Hunnan, China).

(312) Dual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancerInternational Journal of OncologyFebruary 1, 2015TAKESHI CHIYOMARU et al.XhoI-PmeI restriction sites in the 3′-untranslated region (UTR) of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). miRNA target sequences targeted by miR-23b and miR-27b are summarized in

(313) Short loop-targeting oligoribonucleotides antagonize Lin28 and enable pre-let-7 processing and suppression of cell growth in let-7-deficient cancer cellsNucleic acids researchJanuary 1, 2015Roos M, Rebhan MA, Lucic M, Pavlicek D, Pradere U, Towbin H, Civenni G, Catapano CV, Hall J.from Microsynth (Balgach) and cloned into the NotI and XhoI restriction sites of psiCHECK-2 plasmid (C8021; Promega, Fitchburg). The primers used for cloning as well as the inserted sequences in the psiCHECK2

(314) HIV-1 Tat C modulates NOX2 and NOX4 expressions through miR-17 in a human microglial cell lineJournal of NeurochemistryDecember 1, 2014Vaishnavi Sunil Jadhav, Karl-Heinz Krause, Sunit K. SinghLuciferase reporter assay Luciferase reporter clones of intact sequences WT NOX2 30 UTR (cloned in psiCHECK-2 Vector, #C8021; Promega, Madison, WI, USA), WT NOX4 30 UTR (#HmiT054569-MT01; GeneCopeia), mutant-NOX2 30 UTR clone,

(315) Angiotensin II-regulated microRNA 483-3p directly targets multiple components of the renin-angiotensin systemJournal of molecular and cellular cardiologyOctober 1, 2014Kemp JR, Unal H, Desnoyer R, Yue H, Bhatnagar A, Karnik SS.luciferase reporter expression vector, which contains unique Xho1 and Not1 restriction sites (Cat. No. C8021; Promega, WI, USA). Genomic DNA was isolated from human kidney epithelial (HEK-293) cells using a DNeasy

(316) miR-34a regulates mesangial cell proliferation via the PDGFR-β/Ras-MAPK signaling pathwayCellular and molecular life sciences : CMLSOctober 1, 2014Chen D, Li Y, Mei Y, Geng W, Yang J, Hong Q, Feng Z, Cai G, Zhu H, Shi S, et al.targeting sequence, was cloned into the psiCHECK dual-luciferase reporter plasmid (Promega, USA; cat. no. C8021) to produce psiCHECK-WT-PDGFR-β, psiCHECK-WT-cyclin E, or psiCHECK-WT-CDK2, respectively, using PCR.

(317) Embryonic stem cell-specific microRNAs contribute to pluripotency by inhibiting regulators of multiple differentiation pathwaysNucleic acids researchAugust 1, 2014Gruber AJ, Grandy WA, Balwierz PJ, Dimitrova YA, Pachkov M, Ciaudo C, Nimwegen Ev, Zavolan M.mutated, were verified by sequencing and then subcloned into the empty psiCHECK-2 vector (Promega; C8021) at XhoI - NotI restriction sites. The sequences of the primers used for cloning and mutagenesis can

(318) Tumor-suppressive microRNA-29s inhibit cancer cell migration and invasion via targeting LAMC1 in prostate cancerInternational Journal of OncologyJuly 1, 2014RIKA NISHIKAWA et al.inserted between the XhoI-PmeI restriction sites in the 3'-UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). PC3 cells were transfected with 5 ng of the vector and 10 nM miR-29s using

(319) Tumor‐suppressive micro RNA ‐218 inhibits cancer cell migration and invasion via targeting of LASP 1 in prostate cancerCancer ScienceJuly 1, 2014Rika Nishikawa et al.inserted between the XhoI–PmeI restriction sites in the 3′-UTR of the hRluc gene in the psiCHECK-2 vector (C8021 [Promega, Madison, WI, USA]). The protocol for vector construction was as described previously.(16)

(320) MicroRNA-26a regulates glucose metabolism by direct targeting PDHX in colorectal cancer cellsBMC cancerJune 16, 2014Chen B, Liu Y, Jin X, Lu W, Liu J, Xia Z, Yuan Q, Zhao X, Xu N, Liang S.PDHX mRNA was cloned in the downstream of the Renilla luciferase gene in the psiCHECK-2 vector (Cat. # C8021, Promega, USA), which contains a reporter gene Renilla luciferase and an intraplasmid transfection normalization

Be the First to Write a Review!