HiScribeT7 Quick High Yield RNA Synthesis Kit from New England Biolabs

Product Specs
ItemHiScribeT7 Quick High Yield RNA Synthesis Kit
CompanyNew England Biolabs
Price $298.00 Inquire
Catalog NumberE2050S
Quantity50 reactions
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Nonenzymatic Detection of SARS-CoV-2 RNA Using DNA NanoswitchesACS Nano MedicineSeptember 9, 2026Javier Vilcapoma, Asmer Aliyeva, Andrew Hayden, Arun Richard Chandrasekaran, Lifeng Zhou, Jibin Abraham Punnoose, Darren Yang, Clinton H. Hansen, Simon Chi-Chin Shiu, Alexis Russell, et al.purified N gene PCR product as input using NEB HiScribe T7 Quick Yield RNA Synthesis Kit (NEB catalogu no. E2050S) following the manufacturer’s protocol with the following modifications: 1 μL of Sigma polyvinylsulfonic

(2) A Luciferase-Based Assay for Assessing Cap-Independent Translation in Wheat Germ ExtractBio ProtocAugust 20, 2026Max Cortot, Thorsten Stehlik, Aline Koch, Timo Schlemmer81290-1-RR) 25. HiScribe® T7 Quick High Yield RNA Synthesis kit (New England Biolabs, catalog number: E2050S) 26. Lithium chloride (Carl Roth, CAS number: 7447-41-8) 27. Methanol (Thermo Fisher Scientific, CAS

(3) Dynamic SOX2 Gene Expression Revealed by Phase-Separated Single RNA Imaging in Live Porcine CellsJournal of Biological ChemistryAugust 11, 2026Chaoqian Jiang, Zhongyu Yuan, Chuanpei Li, Tianze Li, Jiayan Wu, Dongyan Yang, Xueqing Liu, Zhuoran Yu, Yuchang Yao, Zhonghua Liu, et al.5′-biotin-labeled primers. In vitro-transcribed sgRNA was synthesized using the HiScribe T7 Kit (NEB,Cat.No. E2050S). RNP complexes (Cas9 + sgRNA) and donor fragments were electroporated into PK15 cells. After puromycin

(4) Single-cell chromatin state transitions during epigenetic memory formationSci AdvJuly 24, 2026Taihei Fujimori, Abby R. Thurm, Simon Gaudin, Carolina Rios-Martinez, Benjamin R. Doughty, Michaela M. Hinks, Joydeb Sinha, Derek Le, Antonina Hafner, William J. Greenleaf, et al.RNA was synthesized from the PCR product using HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB, E2050S). The single-stranded RNA was then converted into single-stranded DNA (ssDNA) using the Maxima H Minus

(5) Employing molecular beacons to assess in vitro transcription with single-molecule resolutionScientific ReportsJune 10, 2026Vadim G. Bogatyr, Fatema-Zahra M. Rashid, Andreas S. Biebricher, Wilhelm T. S. Huck, Gijs J. L. WuiteUSA",M0251S NEB HiScribe,HiScribe® T7 Quick High Yield RNA Synthesis Kit,"New England Biolabs, USA",E2050S Invitrogen,T7 RNA Polymerase,"Thermo Fisher Scientific, USA","18,033,019" Promega,T7 RNA Polymerase,"Promega,

(6) Chromatin-associated intronic RNAs from long genes form introsomes that shape nuclear architecture in neuronal cellsbioRxivMay 30, 2026Wenjing Kang, Wing Hin Yip, Xiaoze Li-Wang, Quentin Verron, Britta A.M. Bouwman, Simona Pedrotti, Andrea Abou Yaghi, Mitsuyoshi Murata, Lorenzo Salviati, Erik Wernersson, et al.as template, using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, cat. no. E2050S) in presence of RNaseOUT (Thermo Fisher Scientific, cat. no. 10777019). We purified the RNA product

(7) International multisite implementation of distributed cell-free protein biomanufacturing to advance health and research equityScience advancesMay 29, 2026da Silva SJR, Matthews Q, Cazaux S, Vigar JRJ, Santos BNR, Carvalho DCM, Cranmer LA, Duplat D, Singh S, Simchi M, et al.in an in vitro transcription reaction with the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB, E2050S) according to the manufacturer’s instructions, with the primers listed in data S7. RNA samples were

(8) Carbonic Anhydrase 2 and Na+/K+-ATPase Mediate Family-Dependent Nitrite Tolerance via Modulating Branchial Ion Transport and Acid–Base Balance in Penaeus vannameiAnimals (Basel)May 27, 2026Liping Zhou, Zhentao Ma, Xiuli Chen, Qingyun Liu, Yuliu Huang, Chunling Yang, Digang Zeng, Zhihong Zheng, Bin Zhang, Yueling Zhang, et al.the HiScribe T7 Rapid High-Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA, Cat. No. E2050S), and dsEGFP was used as the negative control. Shrimp were randomly assigned to three groups and intramuscularly

(9) A pathogen lncRNA secreted into rice sequesters a host miRNA for virulenceNatureMay 20, 2026Min He, Jia Su, Xiaogang Zhou, Tuo Qi, Jiazheng Wang, Tianxin Zhang, Jinhua Chen, Mawsheng Chern, Youpin Xu, Xiang Lu, et al.by in vitro transcription with HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs; E2050S) using 1 μg of each cDNA transcription template produced by PCR amplification with primer pairs listed

(10) Quantification of disease-associated RNA tandem repeats by nanopore sensingNature CommunicationsMay 8, 2026Gerardo Patiño-Guillén, Jovan Pešović, Marko Panić, Max Earle, Anastasija Ninković, Sergiu Petrușca, Dušanka Savić-Pavićević, Ulrich F. Keyser, Filip Boškovićwas then carried out using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB, Catalogue number E2050S) following the manufacturer’s recommendations. Transcription was carried out at 37 °C for 4 h using

(11) Genome-wide screening reveals producer-cell modifications that improve virus-like particle production and delivery potencyNat CommunApril 24, 2026Diana Ly, Hyewon Jang, Adhiraj Goel, Arnav Singh, Aditya Raguramin vitro transcription using the HiScribe® T7 Quick High Yield RNA Synthesis Kit (New England Biolabs; E2050S). Transcribed RNA yield was quantified using the QubitTM RNA High-Sensitivity Assay Kit (Thermo Fisher Scientific

(12) SFPQ Promotes Homologous Recombination via mRNA Stabilization of RAD51 and Its ParalogsJournal of Molecular BiologyApril 15, 2026Sofia Gotthold, Keile R. Hansen, Andrew N. Brown, Soham P. Chowdhury, Christine M. Joyce, Viraj Vinish, Sofie I. Rodriguez, Sambhav Jain, Hannah I. Ghasemi, Amanda C. Yoon, et al.in vitro using T7 RNA polymerase (HiScribe T7 Quick High Yield RNA Synthesis Kit; New England Biolabs, Cat#E2050S), followed by DNase I treatment to remove residual DNA. The 5′ triphosphate groups were removed by incubation

(13) Whole-organism spatial transcriptomics at single-cell resolution in C. elegansbioRxivApril 11, 2026Jose David Aguirre, Xuan Wan, Carsten H. Tischbirek, Nicholas Markarian, Core Francisco Park, Long Cai, Paul W. Sternbergmanufacturer’s instructions. These purified PCR products served as templates for in vitro transcription (NEB, E2050S) and were supplemented with RNasin RNase Inhibitor (Promega, N261A) and Pyrophosphatase (NEB, M0361S). The

(14) Defects in intron recycling suppress the antiviral response via a mechanism of intronic endogenous dsRNAJournal of Experimental MedicineApril 6, 2026Chaorui Duan, Luke Buerer, Cory Bowers, Allison J. Taggart, Mara H. O’Brien, Sarah Gunasekera, Chien-Ling Lin, Jing Wang, Yi Zeng, Jonathan P. Staley, et al.Alu +ss and Alu –ss RNAs was performed using the HiScribe T7 Quick High Yield RNA Synthesis Kit (Cat# E2050S; New England Biolabs). The synthesized RNAs were subsequently treated with DNase I to remove residual

(15) The SET1/COMPASS subunit RBBP5 orchestrates epigenetic control of global proteostasis and the 12h oscillator to safeguard metabolic and cellular homeostasisbioRxivMarch 20, 2026Syeda Kubra, Michelle Sun, William Dion, Ahmet Catak, Hannah Luong, Haokun Wang, Yinghong Pan, Jia-Jun Liu, Aishwarya Ponna, Lijun Liu, et al.was synthesized using HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Cat. No. E2050S). T7-Rbbp5–695rev sequence: TAATACGACTCACTATAGGAAGCATTCTAAGATTAAACCGTTTTAGAGCTAGAAATAGCA T7-Rbbp5–951forw

(16) Synergistic Inhibition of Porcine Reproductive and Respiratory Syndrome Virus by a Bifunctional 5'-PPP miRNA Combining RIG-I Activation with Sequence-Specific Viral TargetingVirusesMarch 20, 2026Zihang Song, Jiabao Hou, Feng Guo, Longping Chen, Chudong Wang, Xinjie Guo, Ping Li, Wenlong Shen, Jiajun Yang, Hongxu Zhong, et al.using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA, NEB, E2050S) according to the manufacturer’s instructions. DNA templates were generated by annealing complementary

(17) PEGASUS: Unlocking Polarity in Cell-Permeable Cyclic Peptides Using AI Models Built on Massively Parallel Biological AssaysJournal of Medicinal ChemistryMarch 12, 2026Cole Baker, Francis A. Acquah, Lakshmi G. Chivukula, Liping Wu, Laurence Philippe-Venec, Mostafa Abedi, Yujun Tao, Daniel Ramírez, Matthew D. McCoy, Brandon Moore, et al.library DNA was transcribed into mRNA using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB, E2050S) in 30 μL containing 40 units of Recombinant RNase Inhibitor (Takara, 2313A) for 20 min at 37 °C, followed

(18) An advanced rapid-visual CRISPR assay for detecting porcine reproductive and respiratory syndrome virusScientific ReportsMarch 11, 2026Jiajia Guo, Suyu Shi, Shengsong Xie, Lu Jing, Cui Wang, Dagang Taoagarose gel electrophoresis. In vitro transcription was performed using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (E2050S, New England Biolabs) under standard cycling conditions. The synthesized RNA was quantified with the

(19) La protein binding to telomerase RNA supports an evolutionary relationship between plant and ciliate telomerase pathwaysNucleic Acids ResMarch 10, 2026Leon Jenner, Dzmitry Pruchkouski, Barbora Štefanovie, Olga Nováková, Monika Kubíčková, Petr Fajkus, Marie Brázdová, Jan Paleček, Eva Sýkoroválabelling RNA was synthesized using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, #E2050S) to transcribe a PCR product amplified from pCRII TOPO plasmid DNA sequences using primers detailed

(20) Attenuation of epicardial activation and myofibroblast abundance via the Fbln2-Nupr1b axis stimulates cardiac regeneration in zebrafishNat Cardiovasc ResMarch 3, 2026Gülsüm Kayman Kürekçi, Gursimran Kaur Bajwa, Shaoqiu Zhang, Séverine Leclerc, Emilie de Chantal, Darrell Belke, Gregor Andelfinger, Justin F. Deniset, Rubén Marín-Juezin vitro transcription using a HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, catalog number E2050S). One-cell-stage fbln2FLD−/− embryos were injected with 100 pg of fbln2 mRNA and collected at 3 days

Be the First to Write a Review!