HiScribeT7 Quick High Yield RNA Synthesis Kit from New England Biolabs

Product Specs
ItemHiScribeT7 Quick High Yield RNA Synthesis Kit
CompanyNew England Biolabs
Price $298.00 Inquire
Catalog NumberE2050S
Quantity50 reactions
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(41) Systematic discovery of subcellular RNA patterns in the gut epitheliumGenome BiolOctober 29, 2025Minkyoung Lee, Ilhan E. Acar, Davide Eletto, Srivathsan Adivarahan, Farah Mhamedi, Kristina Handler, Jihyun Lee, Elena Guido Vinzoni, Gustavo Aguilar, Andreas E. Moorof the in vitro transcription (HiScribe™ T7 Quick High Yield RNA Synthesis Kit; New England Biolabs, E2050S), performed at 37 °C for 16 h, followed by DNAseI treatment (37 °C for 15 min). IVT RNAs were then cleaned

(42) VGRCOT: a one-tube visual detection method for group B Streptococcus combining RPA and CRISPR/Cas12a for point-of-care testing in reproductive healthMicrobiol SpectrOctober 7, 2025Caixia Ji, Liqiang Ru, Tiao Han, Gang Mai, Laibao Zheng, Yayun Jiangdetection. MATERIALS AND METHODS Reagents LbCas12a (Catalog # M0653T) and RNA transcription Kits (Catalog # E2050S) were purchased from New England Biolabs Inc. (United States). RAA FAST (Catalog # B00000), the recombinase

(43) Pore-Based RNA Evaluation for Control of Integrity, Sequence, and Errors – Quality Control (PRECISE-QC)bioRxivSeptember 26, 2025Yvonne Y. Yee, Dinara Boyko, Bhoomika Pandit, Maksim Royzen, Sara H. Rouhanifard, Meni Wanunuthrough in vitro transcription (IVT) using the HiScribe T7 Quick High Yield RNA Synthesis kit (NEB E2050S). During IVT, 1 μg of template was used and the sample was incubated at 37°C for 2 h. After IVT, the

(44) Joint single-cell profiling of Cas9 edits and transcriptomes reveals widespread off-target events and effects on gene expressionbioRxivSeptember 24, 2025Michael H. Lorenzini, Brad Balderson, Karthyayani Sajeev, Aaron J. Ho, Graham McVickerperformed in an RNase-free environment using the HiScribe T7 Quick RNA synthesis kit (New England BioLabs #E2050S). For IVT on purified gDNA, gDNA was extracted from donor-edited and control cells using a Quick-DNA

(45) SFPQ Promotes Homologous Recombination via mRNA Stabilization of RAD51 and Its ParalogsbioRxivSeptember 16, 2025Sofia Gotthold, Keile R. Hansen, Andrew N. Brown, Soham P. Chowdhury, Hannah I. Ghasemi, Amanda C. Yoon, Christine M. Joyce, Julien Bacal, Brooke M. Gardner, Chris D. Richardsonin vitro using T7 RNA polymerase (HiScribe T7 Quick High Yield RNA Synthesis Kit; New England Biolabs, Cat#E2050S), followed by DNase I treatment to remove residual DNA. The 5′ triphosphate groups were removed by incubation

(46) Hemocyanin controls Vibrio levels in hemolymph by modulating intracellular ROS via p38 MAPKVirulenceAugust 25, 2025Jiawei Cheng, Yunyu Shi, Yonghui Kong, Yuxi Wu, Yankang Wang, Jude Juventus Aweya, Shiyuan Bao, Junjie Nie, Qian Feng, Yongzhen Zhao, et al.protein, GFP 20,473,140) were synthesized using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (#E2050S, New England Biolabs, Ipswich, MA, USA). The dsRNA was dissolved in DEPC-treated water (#R0022, Beyotime

(47) Cascade amplification of therapeutic payloads for cancer immunotherapyCommun BiolAugust 25, 2025Yingzhong Li, Jiayu Wu, Na Li, Maoqing Wu, Zongqi Wang, Jiahe Li, Libin Zhang(IVT) from the templates of linearized VEE DNA constructs using the NEB RNA synthesize kit (Catalog No. E2050S). Then the synthesized mRNAs were capped and methylated by Cellscript kits (Catalog No. C-SCCS1710).

(48) An image-based transcriptomics atlas reveals the regional and microbiota-dependent molecular, cellular, and spatial structure of the murine gutbioRxivJuly 30, 2025Rosalind J. Xu, Paolo Cadinu, Phillip B. Nicol, Uli S. Herrmann, Tyrone Lee, Ludwig Geistlinger, Rafael A. Irizarry, Jeffrey R. MoffittD4004). The product was amplified and converted to RNA with a high yield in vitro transcription (NEB E2050S) and purified with home-made solid-phase reversible immobilization beads37 (based on Cytiva 65152105050250).

(49) The type 6 secretion system immunity protein RhsFI has been repurposed for small RNA regulation in pathogenic Escherichia coliNucleic Acids ResJuly 19, 2025Thomas Zammit, Brandon Sy, Vadim Shchepachev, Daniel G. Mediati, Pranita Poudyal, Dougall Norris, Samuel Bang, Saleh Alquethamy, Winton Wu, Asim Ullah, et al.malM 3′UTR, vigR 3′ UTR, and rhsFI RNA species were IVT using the HiScribe T7 RNA synthesis kit (NEB #E2050S) from PCR-generated DNA templates incorporating the T7 promoter (see Supplementary Table S4 for primers).

(50) In vivo detection of antisense HIV-1 transcripts in untreated and ART-treated individualsLife Sci AllianceJuly 14, 2025Adam A Capoferri, Rachel Sklutuis, Toluleke O Famuyiwa, Sachi Pathak, Rui Li, Jason W Rausch, Brian T Luke, Rebecca Hoh, Steven G Deeks, John W Mellors, et al.precipitation (described below). RNA was transcribed using HiScribe T7 Quick High Yield RNA Synthesis Kit (#E2050S; New England Biolabs) for AST or the HiScribe SP6 Quick High Yield RNA Synthesis Kit (#E2070S; New England Biolabs

(51) A rapid LASV detection method based on CRISPR-Cas13a and recombinase aided amplification with special lateral-flow test stripsSci RepJuly 1, 2025Tong Wei, Yujie Yan, Mengwei Niu, Xue Dong, Hao Li, Yansong Sun, Yunzhi Falaboratory. Main reagents and devices NTP mix (art. No. N0466S), and T7 transcription kit (art. No. E2050S) and T7 RNA polymerase (art. No. E2050S), and RNase inhibitors (art. No. E2050S) were purchased from

(52) High-resolution dynamic imaging of chromatin DNA communication using Oligo-LiveFISHCellJune 12, 2025Yanyu Zhu, Ashwin Balaji, Mengting Han, Leonid Andronov, Anish R. Roy, Zheng Wei, Crystal Chen, Leanne Miles, Sa Cai, Zhengxi Gu, et al.were synthesized in vitro by T7 RNA polymerase (HiScribe™ T7 Quick High Yield RNA Synthesis Kit, NEB, E2050S). The IVT RNA was treated with RNase-free DNaseI to digest the DNA template for 20 min and purified

(53) DNA Hanger: Surface‐Minimized Single‐Molecule Immunoassay PlatformSmallJune 8, 2025Jincheol Seol, Byungju Kim, Eui‐Sang Yu, Cherlhyun Jeong, Jong‐Bong Lee] The final RNA template was synthesized using the HiScribe T7 Quick High Yield RNA Synthesis Kit (E2050S, NEB), following the manufacturer's instructions. The construct used was 5′‐ctcgaggtcgacggtatcgataagcttgaagac(a)25‐3′

(54) A boundary-defining protein facilitates megabase-scale regulatory chromosomal loop formation in Drosophila neuronsGenes & DevelopmentJune 2, 2025Marion Mouginot, Sahar Hani, Pascal Cousin, Julien Dorier, Arianna Ravera, Maria Cristina Gambettapurification kit (Qiagen 28004) and transcribed using a HiScribe T7 Quick high-yield RNA synthesis kit (NEB E2050S) overnight at 37°C. Reverse transcription was done using M-MLV (Thermo Fisher 28025013) and the forward

(55) Lineage recording in monoclonal gastruloids reveals heritable modes of early developmentbioRxivMay 28, 2025Samuel G. Regalado, Chengxiang Qiu, Sanjay Kottapalli, Beth K. Martin, Wei Chen, Hanna Liao, Haedong Kim, Xiaoyi Li, Jean-Benoît Lalanne, Nobuhiko Hamazaki, et al.500 xg for 3 minutes at 4 °C and resuspended in 60 μL SPBSTM for the T7 reaction (NEB HiScribe kit #E2050S), adding 75 μL of the NTP/buffer mix and 15 μL of the enzyme mix. The nuclei were incubated at 37 °C

(56) Nucleoporins shape germ granule architecture and balance small RNA silencing pathwaysNat CommunMay 8, 2025Kun Shi, Ying Zhang, Zhenzhen Du, Symonne C. Liu, Ivan Leon, Xinyu Fan, Heng-Chi Lee, Donglei Zhangtranscribed in vitro using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, E2050S) and purified with the Monarch RNA Cleanup Kit (New England Biolabs, T2040L). The 3xFLAG/GFP/tagRFP

(57) Combining Multiplexed CRISPR/Cas9-Nickase and PARP Inhibitors Efficiently and Precisely Targets Cancer CellsCancer ResMay 6, 2025Soyoung Lee, Kyunghwan Kim, Hye-Jin Jeong, Subin Choi, Himchan Cheng, Dayoung Kim, Soomin Heo, Jinhee Mun, Minjong Kim, Eunjin Lee, et al.containing a T7 promoter and sgRNA sequence using HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB, #E2050S). A DNA template was produced by extension PCR using 100 µmol/L of each primer and NEBNext High-Fidelity 2X PCR Master Mix

(58) Cas9 endonuclease: a molecular tool for in vitro cloning and CRISPR edit detectionFront Genome EdApril 1, 2025Xingliang Ma, Dhouha Kthiri, Manpartik S. Gill, Curtis J. Pozniak, Sateesh KagaleKit (NEB, catalog no. E3322S) or the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB, catalog no. E2050S), according to the manufacturer’s protocols. All primers and oligonucleotides were synthesized by IDT

(59) Genomic context-dependent histone H3K36 methylation by three Drosophila methyltransferases and implications for dedicated chromatin readersNucleic Acids ResearchApril 1, 2025Muhunden Jayakrishnan, Magdalena Havlová, Václav Veverka, Catherine Regnard, Peter B Beckerprocessed for western blot or immunofluorescence. dsRNA was generated by in vitro transcription (NEB T7 E2050s transcription kit) from polymerase chain reaction (PCR) products generated by the following forward

(60) The Na + -K + -ATPase alpha subunit is an entry receptor for white spot syndrome virusmBioMarch 12, 2025Junyi Zhou, Huimin Zhang, Gaochun Wu, Yinghao Zhang, Jude Juventus Aweya, Muhammad Tayyab, Jinghua Zhu, Yueling Zhang, Defu Yaoin vitro using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, USA, Cat. No. E2050S) according to the manufacturer’s protocol. As a negative control, dsRNA targeting EGFP (dsEGFP) was

Be the First to Write a Review!