HiScribeT7 Quick High Yield RNA Synthesis Kit from New England Biolabs

Product Specs
ItemHiScribeT7 Quick High Yield RNA Synthesis Kit
CompanyNew England Biolabs
Price $298.00 Inquire
Catalog NumberE2050S
Quantity50 reactions
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(81) An autoimmune transcriptional circuit drives FOXP3 + regulatory T cell dysfunctionScience Translational MedicineAugust 28, 2024Tomokazu S. Sumida, Matthew R. Lincoln, Liang He, Yongjin Park, Mineto Ota, Akiko Oguchi, Raku Son, Alice Yi, Helen A. Stillwell, Greta A. Leissa, et al.adapters [that contain both a promoter for transcription by T7 RNA polymerase (New England Biolabs, no. E2050S) and a demultiplexing adapter] were ligated to the chromatin. Chromatin was mixed overnight with antibodies

(82) Genomic context-dependent histone H3K36 methylation by three Drosophila methyltransferases and implications for dedicated chromatin readersNucleic Acids ResearchJuly 22, 2024Muhunden Jayakrishnan, Magdalena Havlová, Václav Veverka, Catherine Regnard, Peter B Beckerprocessed for Western Blot or Immunofluorescence. dsRNA was generated by in vitro transcription (NEB T7 E2050s transcription kit) from PCR products generated by the following forward and reverse primers (separated

(83) Variants of NAV3, a neuronal morphogenesis protein, cause intellectual disability, developmental delay, and microcephalyCommunications BiologyJuly 8, 2024Amama Ghaffar, Tehmeena Akhter, Petter Strømme, Doriana Misceo, Amjad Khan, Eirik Frengen, Muhammad Umair, Bertrand Isidor, Benjamin Cogné, Asma A. Khan, et al.mRNAs were synthesized using the HiScribe T7 Quick RNA synthesis kit (New England Biolabs Catalog no. E2050S). A dosage response was performed to optimize the mRNA dose using the NAV3WT mRNA at 250 pg, 500 pg,

(84) Modifying miRs for effective reprogramming of fibroblasts to cardiomyocytesMolecular therapy. Nucleic acidsJune 11, 2024Wang X, Baksh SS, Pratt RE, Dzau VJ, Hodgkinson CP.triphosphate end were produced via a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S/E2050S). We initially created a DNA template by annealing matching oligonucleotides. The annealing solution

(85) Development and field validation of a reverse transcription loop-mediated isothermal amplification assay (RT-LAMP) for the rapid detection of chikungunya virus in patient and mosquito samplesClinical Microbiology and InfectionJune 1, 2024Severino Jefferson Ribeiro da Silva, Jurandy Júnior Ferraz de Magalhães, Quinn Matthews, Ana Luisa Lot Divarzak, Renata Pessôa Germano Mendes, Bárbara Nazly Rodrigues Santos, Diego Guerra de Albuquerque Cabral, Jacilane Bezerra da Silva, Alain Kohl, Keith Pardee, et al.transcription of synthetic RNA was done overnight using the HiScribe T7 Quick High Yield RNA Synthesis Kit (E2050S, NEB) following the manufacturer's instructions. Cells and viruses Vero cells were maintained in Dulbecco's

(86) Transcriptome Analysis Elucidates the Potential Key Genes Involved in Rib Development in bmp6-Deficient Silver Carp (Hypophthalmichthys molitrix)Animals (Basel)May 13, 2024Xiaohui Li, Chunyan Zhang, Cui Feng, Zewen Zhang, Nannan Feng, Hang Sha, Xiangzhong Luo, Guiwei Zou, Hongwei LiangS1), and the gRNA was synthesised using the NEB HiScribe T7 Rapid and Efficient RNA Synthesis Kit (NEB E2050S, USA) (Wuhan, China). Amounts of 400–600 pg of sgRNA and 0.2–0.4 pmol of Cas9 NLS nuclease (NEB M0646T,

(87) Rapid and Sensitive Detection of Verticillium dahliae from Soil Using LAMP-CRISPR/Cas12a TechnologyInternational Journal of Molecular SciencesMay 10, 2024Yuxiao Fang, Lijuan Liu, Wenyuan Zhao, Linpeng Dong, Lijuan He, Yuhan Liu, Jinyao Yin, Yufang Zhang, Weiguo Miao, Daipeng ChenAfter synthesizing crRNA using the T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Cat#E2050S) and purifying it using the RNA Cleanup Kit (New England Biolabs, Cat#T2040S), the purified crRNA was

(88) Charting the cellular biogeography in colitis reveals fibroblast trajectories and coordinated spatial remodelingCellApril 2, 2024Paolo Cadinu, Kisha N. Sivanathan, Aditya Misra, Rosalind J. Xu, Davide Mangani, Evan Yang, Joseph M. Rone, Katherine Tooley, Yoon-Chul Kye, Lloyd Bod, et al.C1012–50), and then amplified and converted to RNA within a high yield in vitro transcription (NEB, E2050S). The RNA was then purified using solid-phase reversible immobilization beads (SPRI). As our nucleic

(89) A double-stranded RNA binding protein enhances drought resistance via protein phase separation in riceNat CommunMarch 21, 2024Huaijun Wang, Tiantian Ye, Zilong Guo, Yilong Yao, Haifu Tu, Pengfei Wang, Yu Zhang, Yao Wang, Xiaokai Li, Bingchen Li, et al.promoter and OsNCED4 3’-UTR sequences using HiScribeTM T7 Quick High Yeild RNA Synthesis Kit (NEB, #E2050S) according to the manufacturer’s instructions. Briefly, 1 μg template DNA, NTP Buffer Mix, T7 RNA Polymerase

(90) Highly sensitive spatial transcriptomics using FISHnCHIPs of multiple co-expressed genesNat CommunMarch 15, 2024Xinrui Zhou, Wan Yi Seow, Norbert Ha, Teh How Cheng, Lingfan Jiang, Jeeranan Boonruangkan, Jolene Jie Lin Goh, Shyam Prabhakar, Nigel Chou, Kok Hao Chenin-vitro transcription that was performed overnight using a high-yield in vitro transcription kit (NEB, cat. no. E2050S). Reverse transcription was then performed on the RNA template using Maxima H- Reverse Transcriptase

(91) Disruption of FLNB leads to skeletal malformation by interfering with skeletal segmentation through the HOX geneBone ReportsFebruary 28, 2024Qiming Xu, Lijia Cui, Yude Lin, Leigh-Anne Cui, Weibo Xiasequence of sgRNA. Then the transcription was performed in vitro using a T7 in vitro transcript kit (#E2050S，NEB, USA), and the sgRNA was purified after ethanol precipitation. The cleavage efficiency of sgRNA

(92) Single-molecule RNA sizing enables quantitative analysis of alternative transcription terminationNature CommunicationsFebruary 24, 2024Gerardo Patiño-Guillén, Jovan Pešović, Marko Panić, Dušanka Savić-Pavićević, Filip Bošković, Ulrich Felix Keyserboth in vitro transcribed using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB, Catalog number E2050S). For each, a 240 ng reaction was prepared according to the manufacturer’s recommendation. In a 20 µL

(93) Chloride transporter ClC-7 is essential for phagocytic clearance by microgliaJournal of Cell ScienceFebruary 15, 2024Harini Iyer, William S. Talbotannealed to tracrRNA template. Assembled oligonucleotides were transcribed using HiScribe T7 Quick (NEB, E2050S) kit. Following DNase treatment, the RNA was purified using mirVana miRNA isolation kit (Invitrogen,

(94) A rapid isothermal CRISPR-Cas13a diagnostic test for genital herpes simplex virus infectioniScienceJanuary 19, 2024Xiaona Yin, Hao Luo, Han Zhou, Ziyan Zhang, Yinyuan Lan, Zhanqin Feng, Wentao Chen, Heping ZhengChina",Cat# Z03486 HiScribe T7 Quick High Yield RNA Synthesis Kit,"New England Biolabs, MA, USA",Cat# E2050S RNA XP Clean Beads,"Beckman, CA, USA",Cat# A63987 Qubit RNA HS Assay Kit,"Thermo Fisher Scientific,

(95) Based on CRISPR-Cas13a system, to establish a rapid visual detection method for avian influenza virusesFrontiers in Veterinary ScienceJanuary 8, 2024Zongshu Zhang, Chunguang Wang, Xi Chen, Zichuang Zhang, Guoqiang Shi, Xianghe Zhai, Tie Zhang10 μL of the reaction product was mixed with 10 μL of NTP buffer mix (New England Biolabs, cat.no. E2050S), 2 μL T7 RNA polymerase mix (New England Biolabs, cat.no. E2050S), 17 μL UltraPure water and then transcribed

(96) A robust knock-in approach using a minimal promoter and a minicircleDevelopmental BiologyJanuary 1, 2024Margaret Keating, Ryan Hagle, Daniel Osorio-Méndez, Anjelica Rodriguez-Parks, Sarah I. Almutawa, Junsu Kang(Genesee Scientific) to generate sgRNA templates. sgRNAs were synthesized using the HiScribe T7 kit (NEB, E2050S) and purified by the RNA purification Kit (Zymogen, R1016) according to the manufacturer's instructions.

(97) Rapid specific detection of oral bacteria using Cas13-based SHERLOCKJournal of Oral MicrobiologyDecember 31, 2023Jett Liu, Camden Carmichael, Hatice Hasturk, Wenyuan Shi, Batbileg Bora ssDNA template, a T7 primer (5’ - GAAATTAATACGACTCACTATAGGG − 3’), and the HiScribe T7 kit (NEB, #E2050S). Growth of target bacteria and gDNA isolation Seven target bacteria were grown in the conditions

(98) An isothermal CRISPR-based diagnostic assay for Neisseria gonorrhoeae and Chlamydia trachomatis detectionMicrobiology SpectrumDecember 12, 2023Hao Luo, Lihong Zeng, Xiaona Yin, Yuying Pan, Jianjiang Yang, Mingjing Liu, Xiaolin Qin, Zhanqin Feng, Wentao Chen, Heping Zheng37°C for 16 h using the HiScribe T7 Quick High Yield RNA Synthesis kit (New England Biolabs, MA, USA; E2050S) for crRNA transcription. RNA XP clean beads (Beckman, Brea, CA; A63987) were used to purify products

(99) Codon optimality modulates protein output by tuning translation initiationbioRxivDecember 1, 2023Elijah F Lyons, Lou C Devanneaux, Ryan Y Muller, Anna V Freitas, Zuriah A Meacham, Maria V McSharry, Van N Trinh, Anna J Rogers, Nicholas T Ingolia, Liana F LareauConcentrate column (Zymo, D4004). In vitro transcription was performed using a T7 Quick HiScribe kit (NEB, E2050S) according to manufacturer’s instructions with overnight incubation at 37°C, then treated with DNase.

(100) The structural basis of mRNA recognition and binding by yeast pseudouridine synthase PUS1PLOS ONENovember 8, 2023Sebastian Grünberg, Lindsey A. Doyle, Eric J. Wolf, Nan Dai, Ivan R. Corrêa, Erbay Yigit, Barry L. Stoddardthe duplex was in vitro transcribed using the HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB # E2050S) following the standard IVT protocol and purified using Monarch® RNA Cleanup columns (NEB # T2030). PUS1

Be the First to Write a Review!