Monarch® Genomic DNA Purification Kit T3010S / T3010L from New England Biolabs

Product Specs
ItemMonarch® Genomic DNA Purification Kit
CompanyNew England Biolabs
Price Supplier Page View Company Product Page
Catalog NumberT3010S / T3010L
Quantity50 or 100 preps
ApplicationsDNA Manipulation, Genomic DNA Purification

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Dual chemical labeling enables nucleotide-resolution mapping of DNA abasic sites and common alkylation damage in human mitochondrial DNANucleic Acids ResearchJuly 21, 2023Chaoxing Liu, Brandon H Le, Wenyan Xu, Ching-Hsin Yang, Yu Hsuan Chen, Linlin Zhaousing GraphPad Prism 9. Measurement of mtDNA copy number Monarch genomic DNA purification kit (NEB, T3010L) was used to extract and purify total DNA from cultured cells. The concentration of DNA was determined

(2) easyPACId, a Simple Method for Induced Production, Isolation, Identification, and Testing of Natural Products from ProteobacteriaBIO-PROTOCOLJuly 5, 2023Edna Bode, Daniela Assmann, Petra Happel, Elmar Meyer, Karin Münch, Nicole Rössel, Helge B. Bode(New England Biolabs, catalog number: R0111L)Monarch Genomic DNA Purification kit (New England Biolabs, catalog number: T3010L)100 bp DNA ladder (New England Biolabs, catalog number: N3231L); 1 kb DNA ladder (New England Biolabs,

(3) Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathyNature CommunicationsJune 22, 2023Markus Grosch, Laura Schraft, Adrian Chan, Leonie Küchenhoff, Kleopatra Rapti, Anne-Maud Ferreira, Julia Kornienko, Shengdi Li, Michael H. Radke, Chiara Krämer, et al.amplicon sequencing DNA from human cells was isolated using the Monarch® Genomic DNA Purification Kit (T3010L, NEB) following the manufacturer’s instructions and including the recommended RNaseA digestion step.

(4) Epigenetic reactivation of tumor suppressor genes with CRISPRa technologies as precision therapy for hepatocellular carcinomaClinical epigeneticsApril 29, 2023Sgro A, Cursons J, Waryah C, Woodward EA, Foroutan M, Lyu R, Yeoh GCT, Leedman PJ, Blancafort P.again. Cell pellets were then processed using a Monarch® Genomic DNA Purification Kit (NEB, Cat. No. T3010L) according to the manufacturer’s protocol. Genomic DNA was shipped at room temperature to the AGRF (Australian

(5) Nrl:CreERT2 mouse model to induce mosaic gene expression in rod photoreceptorsFrontiers in Molecular NeuroscienceApril 25, 2023Molly T. Thorson, Stephanie E. Wei, Craig Johnson, Christopher J. Gabriel, Vadim Y. Arshavsky, Jillian N. Pearringtissue was digested and DNA purified using Monarch® Genomic DNA Purification Kit (New England BioLabs, T3010L). A ~ 2 kb DNA product was PCR amplified using Rd9-F1 (ACACCGTGCACTGAAAATGA) and ORF15 R1476 (TGTGCCATGTCTGCCATATT)

(6) CasKAS: direct profiling of genome-wide dCas9 and Cas9 specificity using ssDNA mappingGenome BiologyApril 21, 2023Georgi K. Marinov, Samuel H. Kim, S. Tansu Bagdatli, Soon Il Higashino, Alexandro E. Trevino, Josh Tycko, Tong Wu, Lacramioara Bintu, Michael C. Bassik, Chuan He, et al.500 g for 5 min at 4 °C. Genomic DNA was then extracted using the Monarch gDNA Purification Kit (NEB T3010S) following the standard protocol but with elution using 175 µL 25 mM K3BO3 at pH 7.0. Click reaction,

(7) Multicellular, IVT-derived, unmodified human transcriptome for nanopore direct RNA analysisbioRxivApril 13, 2023Caroline A. McCormick, Stuart Akeson, Sepideh Tavakoli, Dylan Bloch, Isabel N. Klink, Miten Jain, Sara H. RouhanifardHeLa genomic DNA (gDNA). gDNA extraction was performed using a Monarch Genomic DNA Purification Kit (NEB, T3010S) following the Manufacturer’s protocol for cultured cells with an input of 5e6 HeLa cells. PCR primers

(8) A neurodevelopmental epigenetic programme mediated by SMARCD3–DAB1–Reelin signalling is hijacked to promote medulloblastoma metastasisNature Cell BiologyMarch 1, 2023Han Zou, Bradley Poore, Emily E. Brown, Jieqi Qian, Bin Xie, Evridiki Asimakidou, Vladislav Razskazovskiy, Deanna Ayrapetian, Vaibhav Sharma, Shunjin Xia, et al.lentivirus-infected target cells. For enhancer deletion, genomic DNA was extracted (New England BioLabs, T3010S) and amplified by PCR (ApexBio, K1025), then gel purified (Qiagen, 28704) and sequencing validated.

(9) Multi-omic screening of invasive GBM cells in engineered biomaterials and patient biopsies reveals targetable transsulfuration pathway alterationsbioRxivFebruary 28, 2023Joseph H. Garcia, Erin A. Akins, Saket Jain, Kayla J. Wolf, Jason Zhang, Nikita Choudhary, Meeki Lad, Poojan Shukla, Sabraj Gill, Will Carson, et al.deoxyribonucleic acid (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England BioLabs, T3010S) following procedures for Tissue gDNA isolation. gDNAs from six invasion devices were pooled as one

(10) Influence of Heparan Sulfate Proteoglycans and Factor X on species D Human Adenovirus Uptake and TransductionVirusesDecember 24, 2022Katrin Schröer, Montaha Alshawabkeh, Sebastian Schellhorn, Katrin Bronder, Wenli Zhang, Anja Ehrhardtcollected, and the total genomic DNA (gDNA) was isolated with the Monarch Genomic DNA Purification Kit (T3010L NEB, Frankfurt am Main, Germany). For duplex qPCR, as the house-keeping gene for the CHO cell lines,

(11) DNA Authentication and Chemical Analysis of Psilocybe Mushrooms Reveal Widespread Misdeterminations in Fungaria and Inconsistencies in MetabolitesApplied and Environmental MicrobiologyDecember 20, 2022Alexander J. Bradshaw, Talia A. Backman, Virginia Ramírez-Cruz, Dale L. Forrister, Jaclyn M. Winter, Laura Guzmán-Dávalos, Giuliana Furci, Paul Stamets, Bryn T. M. Dentingerwas used as input to the Monarch genomic DNA purification kit (New England Biolabs [NEB] catalog no. T3010S) following the manufacturer’s instructions except using twice the volume of lysis buffer and increasing

(12) Polarity protein SCRIB interacts with SLC3A2 to regulate proliferation and tamoxifen resistance in ER+ breast cancerCommunications BiologyDecember 1, 2022Yasuhiro Saito et al.in Supplementary Fig. 7. Genomic DNAs were extracted using Monarch Genomic DNA Purification Kit (NEB T3010S). We used 10 ng genomic DNA for the PCR template. PCR was conducted using KOD Plus Neo (TOYOBO KOD-401)

(13) The chromatin organization of a chlorarachniophyte nucleomorph genomeGenome BiologyDecember 1, 2022Georgi K. Marinov, Xinyi Chen, Tong Wu, Chuan He, Arthur R. Grossman, Anshul Kundaje, William James Greenleafin 100 μL cold 1× PBS. Genomic DNA was then extracted using the Monarch gDNA Purification Kit (NEB T3010S) following the standard protocol but with elution using 85 μL 25 mM K3BO3 at pH 7.0. The click reaction

(14) Modulation of Breast Cancer Cell FASN Expression by Obesity-Related Systemic FactorsBreast Cancer: Basic and Clinical ResearchAugust 22, 2022Bryan McClellan, Tommy Pham, Brittany Harlow, Gabby Lee, Duan Quach, Christopher Jolly, Andrew Brenner, Linda deGraffenriedwas isolated per manufacturer’s protocol using DNA purification spin columns (New England Biolabs, T3010S). Purified DNA was then subjected to quantitative polymerase chain reaction (qPCR) amplification with

(15) Properties of Adenovirus Vectors with Increased Affinity to DSG2 and the Potential Benefits of Oncolytic Approaches and Gene TherapyVirusesAugust 21, 2022Nora A. Bahlmann, Raphael L. Tsoukas, Sebastian Erkens, Hongjie Wang, Franziska Jönsson, Malik Aydin, Ella A. Naumova, André Lieber, Anja Ehrhardt, Wenli Zhangintensive washing with PBS. Genomic DNA was extracted using Monarch Genomic DNA Purification Kit (NEB, T3010L). To monitor virus genome uptake efficiency, quantitative polymerase chain reaction (qPCR) analysis

(16) Telomere length in patients with alcohol-associated liver disease – a brief reportJournal of Investigative MedicineAugust 1, 2022Nazmul Huda, Praveen Kusumanchi, Kristina Perez, Yanchao Jiang, Nicholas J Skill, Zhaoli Sun, Jing Ma, Zhihong Yang, Suthat Liangpunsakulgenomic DNAs from human liver tissues using Monarch genomic DNA isolation kit (New England Biolabs, Cat#T3010L). Once isolated, they were digested with HinfI and RsaI. The DNA fragments were separated by electrophoresis

(17) Efficient suppression of endogenous CFTR nonsense mutations using anticodon-engineered transfer RNAsMolecular Therapy - Nucleic AcidsJune 14, 2022Wooree Ko, Joseph J. Porter, Matthew T. Sipple, Katherine M. Edwards, John D. Lueckquantitative real-time PCR. Genomic DNA (gDNA) was extracted using the Monarch Genomic DNA Purification Kit (NEB; no. T3010S) according to manufacturer’s instructions. Genomic integrants of the PB transposon expressing 16 copies

(18) Single-Molecule Multikilobase-Scale Profiling of Chromatin Accessibility Using m6A-SMAC-Seq and m6A-CpG-GpC-SMAC-SeqMethods in Molecular BiologyJune 2, 2022Georgi K. Marinov, Zohar Shipony, Anshul Kundaje, William J. Greenleaffor isolating HMW can also be applied, such as the NEB Monarch Genomic DNA Purification Kit (Cat # T3010S/T3010L), the Nanobind CBB Big DNA Kit (Cat # SKU NB-900-001-01), and others. 2.3 HMW DNA size selection Several

(19) DiMeLo-seq: a long-read, single-molecule method for mapping proteinâ€“DNA interactions genome wideNature MethodsJune 1, 2022Nicolas Altemose, Annie Maslan, Owen K. Smith, Kousik Sundararajan, Rachel R. Brown, Reet Mishra, Angela M. Detweiler, Norma Neff, Karen H. Miga, Aaron F. Straight, et al.protocols.io). Depending on the desired read length, either the NEB Monarch Genomic DNA Purification Kit (T3010S) or the NEB Monarch HMW DNA Extraction Kit (T3050L) with 2000 rpm agitation was used to extract DNA

(20) Generation of a zebrafish knock-in line expressing MYC-tagged Sox11a using CRISPR/Cas9 genome editingBiochemical and Biophysical Research CommunicationsJune 1, 2022Laura A. Krueger, Ann C. Morrisextracted from tails of sox11aMYC and wildtype fish with Monarch Genomic DNA Purification Kit (NEB: T3010S, Ipswich, MA). Targeted amplicons and rhAMP Seq library were produced according to the rhAmpSeq library

Write a Review

(1)

10/6/2023Good Kit From New England Biolabs Ideal for the Isolation of Genomic DNA Anh NguyenI extracted the genomic DNA from bacterial liquid culture with this kit to clone bacterial genes. This method yielded enough amount of genomic DNA for many PCR reactions I have run.
(1)

8/14/2023Highly Recommended Genomic DNA Isolation Kit From New England BioLabs Pavan Kumar ChodisettiIn order to clone bacteria genes, I must extract genomic DNA (gDNA) using this kit, which is more efficient than the traditional cetyltrimethylammonium bromide (CTAB) method.
(1)

3/1/2023Excellent gDNA Isolation with Monarch Genomic DNA Purification Kit Filippo MassaIn our study we applied CRISPR/Cas9 approaches to knockout several alleles in cell lines (immortalized B cells, HEK293). To facilitate PCR amplification before sequencing we isolated clean gDNA form ... Read Review
(1)

12/28/2022Easy and Quick DNA Purification Scarlette CASSALEasy and quick purification of genomic DNA from various samples (cultured cells, whole blood and animal tissue). Allow the obtention of good quality DNA, without protein nor solvent contamination.

Related Products

Item	Catalog Number	Get Quote
Monarch Genomic DNA Purification Kit	T3010S	Supplier Page
Monarch Genomic DNA Purification Kit	T3010L	Supplier Page

Monarch® Genomic DNA Purification Kit

Purify high-quality, genomic DNA from a broad range of sample types (cell, blood, tissues, and more).

Achieve high yields from challenging tissues that are difficult for many commercial kits (e.g. fatty, fibrous, and soft organ tissues).

Monarch® Genomic DNA Purification Kit

Monarch® Genomic DNA Purification Kit from New England Biolabs

Description

New England Biolabs

Citations (27)

Reviews

Related Products

Monarch® Genomic DNA Purification Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map