pRL-CMV Vector from Promega

Product Specs
ItempRL-CMV Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2261
HostMammalian
Vector NamepRL-CMV
ResistanceAmpR
ReporterRenilla luciferase
Quantity20microg
PromoterCMV Enhancer and Immediate early promoter
Molecular Weight~66kDa
Selectable MarkerAmpicillin

Specifications/Features

Vector Size:
4079 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(81) PERK signaling through C/EBPδ contributes to ER stress-induced expression of immunomodulatory and tumor promoting chemokines by cancer cellsCell death & diseaseNovember 1, 2021Sheshadri N, Poria DK, Sharan S, Hu Y, Yan C, Koparde VN, Balamurugan K, Sterneck E.along with C/EBPδ expression constructs [70]. Renilla luciferase expression plasmid, pRL-CMV (Promega E2261) was used as an internal transfection control. Dual luciferase activity was assessed 48 h after transfection

(82) EGFR inhibition enhances the cellular uptake and antitumor-activity of the HER3 antibody drug conjugate HER3-DXdCancer ResSeptember 21, 2021Heidi M. Haikala, Timothy Lopez, Jens Köhler, Pinar O. Eser, Man Xu, Qing Zeng, Tyler J. Teceno, Kenneth Ngo, Yutong Zhao, Elena V. Ivanova, et al.Addgene #60899) and 100ng of the Renilla luciferase-expressing pRL-CMV control plasmid (Promega, Cat# E2261) for 24hrs using Fugene HD transfection reagent (Promega Cat#E2311). Cells were then drug treated and

(83) Parallel characterization of cis-regulatory elements for multiple genes using CRISPRpathScience AdvancesSeptember 17, 2021Xingjie Ren et al.Sanger sequencing, the vectors were cotransfected with pRL-CMV-Renilla luciferase vector (Promega, E2261) in WTC11 iPSCs with FuGENE HD (Promega, E2311) at a 3:1 reagent to DNA ratio. pGL4.13-SV40-Firefly

(84) An optimized protocol with a stepwise approach to identify specific nuclear receptor ligands from cultured mammalian cellsSTAR ProtocolsSeptember 17, 2021Alexandre Berthier, Bart Staels, Philippe Lefebvre2018,N/A p(UAS)4-tk-SEAP,This article,N/A p-RL (CMV) [renilla luciferase normalization vector],Promega,Cat# E2261 p-EGFP-hCAR1,GeneCopoeia,Cat# EX-A0964-M29 pGal4-Rev-erbα,Hering et al. 2018,N/A pVP16-NCoR,Hering

(85) Genes with 5′ terminal oligopyrimidine tracts preferentially escape global suppression of translation by the SARS-CoV-2 Nsp1 proteinRNASeptember 1, 2021Shilpa Rao, Ian Hoskins, Tori Tonn, P. Daniela Garcia, Hakan Ozadam, Elif Sarinay Cenik, Can CenikNM_001636) were custom synthesized (IDT) and cloned into pRL-CMV Renilla luciferase vector (Promega, E2261) using oligos in Supplementary file 1. Briefly, pRL-CMV was digested with NdeI and NheI followed by

(86) Telomerase reverse transcriptase activates transcription of miR500A to inhibit Hedgehog signalling and promote cell invasivenessMolecular oncologyJuly 1, 2021Bernabé-García M, Martínez-Balsalobre E, García-Moreno D, García-Castillo J, Revilla-Nuin B, Blanco-Alcaina E, Mulero V, Alcaraz-Pérez F, Cayuela ML.5′CCTTTACAAAATAATATTACATAAG CAATATT3′. The 3′UTR fragments were cloned in the XbaI site of the pRL‐CMV Vector (Promega, #E2261; pCMV‐Luc‐PTCH1 3′UTR wt/mut). Cells were transfected, and luciferase experiments were performed as

(87) The P300/XBP1s/Herpud1 axis promotes macrophage M2 polarization and the development of choroidal neovascularizationJournal of cellular and molecular medicineJuly 1, 2021Li W, Wang Y, Zhu L, Du S, Mao J, Wang Y, Wang S, Bo Q, Tu Y, Yi Q.of pcDNA3.1‐p300, Flag‐XBP1s, and a reporter plasmid and 10 ng of pRL‐CMV vector (internal control; #E2261, Promega, USA). After transfection, the medium was replaced with serum‐free DMEM, and the cells were

(88) CD137 and PD-L1 targeting with immunovirotherapy induces a potent and durable antitumor immune response in glioblastoma modelsJournal for immunotherapy of cancerJuly 1, 2021Puigdelloses M, Garcia-Moure M, Labiano S, Laspidea V, Gonzalez-Huarriz M, Zalacain M, Marrodan L, Martinez-Velez N, De la Nava D, Ausejo I, et al.E2F1-responsive promoter.29 Additionally, 250 ng of pRL-CMV, which constitutively expresses Renilla luciferase (E2261; Promega), was cotransfected as a transfection control. Twenty-four hours later, firefly and Renilla

(89) Quantitative live-cell imaging and computational modeling shed new light on endogenous WNT/CTNNB1 signaling dynamicseLifeJune 30, 2021Saskia MA de Man, Gooitzen Zwanenburg, Tanne van der Wal, Mark A Hink, RenÃ©e van Amerongenet al., 2007, a kind gift from Christophe Fuerer and Roel Nusse, Stanford University), CMV Renilla (E2261, Promega, Madison, WI), pSGFP2-C1 (Kremers et al., 2007, a kind gift from Dorus Gadella, available from

(90) Quantitative live-cell imaging and computational modeling shed new light on endogenous WNT/CTNNB1 signaling dynamicsElifeJune 30, 2021Saskia MA de Man, Gooitzen Zwanenburg, Tanne van der Wal, Mark A Hink, Renée van Amerongenet al., 2007, a kind gift from Christophe Fuerer and Roel Nusse, Stanford University), CMV Renilla (E2261, Promega, Madison, WI), pSGFP2-C1 (Kremers et al., 2007, a kind gift from Dorus Gadella, available from

(91) Preclinical and clinical characterization of the RORγt inhibitor JNJ-61803534Scientific reportsMay 26, 2021Xue X, De Leon-Tabaldo A, Luna-Roman R, Castro G, Albers M, Schoetens F, DePrimo S, Devineni D, Wilde T, Goldberg S, et al.out by transiently co-transfecting HEK293T cells with pFR-Luc reporter and pRL-CMV reporter (Promega #E2261), pCMV-BD (Stratagene #211342) containing the GAL4 DNA-binding domain fused with full-length human RORγt

(92) USP22 promotes melanoma and BRAF inhibitor resistance via YAP stabilizationOncology lettersMay 1, 2021Wei Y, Jiang Z, Lu J.Gal4-TEAD4 (cat. no. 24640) (both Addgene, Inc.) and pRL Renilla luciferase control reporter (cat. no. E2261; Promega Corporation) using Lipofectamine 3000. After 36 h of transfection, luciferase activity was

(93) Delta-24-RGD, an Oncolytic Adenovirus, Increases Survival and Promotes Proinflammatory Immune Landscape Remodeling in Models of AT/RT and CNS-PNETClinical Cancer ResearchMarch 15, 2021Marc Garcia-Moure, Marisol Gonzalez-Huarriz, Sara Labiano, Elizabeth Guruceaga, Eva Bandres, Marta Zalacain, Lucia Marrodan, Carlos de Andrea, Maria Villalba, Naiara Martinez-Velez, et al.promoter (28). Additionally, 250 ng of pRL-CMV, which constitutively expresses Renilla luciferase (E2261; Promega), was cotransfected as a transfection control. Twenty-four hours later, firefly and Renilla

(94) miR‑769‑5p is associated with prostate cancer recurrence and modulates proliferation and apoptosis of cancer cellsExperimental and Therapeutic MedicineFebruary 8, 2021Daniel Leeor pLenti-UTR-Luc ARHGAP10 MUT1+2 and 4 ng of pRL-CMV Renilla luciferase reporter (Promega; cat. no. E2261) using TransIT-X2 (Mirus; cat. no. 6004). Subsequently, the cells were cultured for 48 h and washed

(95) CD4-Targeted T Cells Rapidly Induce Remissions in Mice with T Cell LymphomaBioMed research internationalJanuary 1, 2021Cheng J, Chen G, Lv H, Xu L, Liu H, Chen T, Qu L, Wang J, Cheng L, Hu S, et al.enzyme digestion. The control reporter plasmid pRL Renilla luciferase reporter pRL-CMV vector (Cat. E2261, Promega, Madison, WI, USA) was used as controls. The fusion protein expression was further determined

(96) S100A8/S100A9 cytokine acts as a transcriptional coactivator during breast cellular transformationScience advancesJanuary 1, 2021Song R, Struhl K.Gal4-based constructs (1 μg), pUAS-luc2 (1 μg; plasmid #24343, Addgene), and pCMV-RL (100 ng; catalog #E2261, Promega) were electroporated together into human breast MCF7 cells by the 4D-Nucleofector System with

(97) Delta-24-RGD, an oncolytic adenovirus, increases survival and promotes proinflammatory immune landscape remodeling in models of AT/RT and CNS-PNETClin Cancer ResDecember 29, 2020Marc Garcia-Moure, Marisol Gonzalez-Huarriz, Sara Labiano, Elizabeth Guruceaga, Eva Bandrés, Marta Zalacain, Lucía Marrodan, Carlos de Andrea, Maria Villalba, Naiara Martinez-Vélez, et al.promoter (28). Additionally, 250 ng of pRL-CMV, which constitutively expresses Renilla luciferase (E2261; Promega), was cotransfected as a transfection control. Twenty-four hours later, firefly and Renilla

(98) Silver Nanoparticles Affect the Inflammatory Response in a Lung Epithelial Cell LineThe Open Biotechnology JournalDecember 22, 2020Alaa Fehaid, Ryo Fujii, Takeshi Sato, Akiyoshi Taniguchiof the luciferase encoding gene (luc+) in different types of mammalian cells. Also, pRL-CMV vector (E2261, Promega), which is a Renilla luciferase-encoding control plasmid, was used as an internal control to

(99) GAS5 regulates diabetic cardiomyopathy via miR‑221‑3p/p27 axis‑associated autophagyMolecular Medicine ReportsDecember 13, 2020Dezhi Chen, Min Zhangthe potential miR-221-3p binding sites were cloned into pRL-CMV luciferase reporter plasmid (cat. no. E2261; Promega Corporation). The mutant (MUT) sequence (GAS5, 5′-CUUAUCGUUUCGCCCACGUA-3′; p27, 5′-CUCUAAACCAGUUGGCAUAGAUA-3′)

(100) Unique Immune Cell Coactivators Specify Locus Control Region Function and Cell StageMolecular cellDecember 3, 2020Chu CS, Hellmuth JC, Singh R, Ying HY, Skrabanek L, Teater MR, Doane AS, Elemento O, Melnick AM, Roeder RG.paper,N/A pFUGW-pCMV-FLAG-MEF2B,This paper,N/A pGL3.basic,Promega,Cat# E1751 pRL-CMV,Promega,Cat# E2261 pGL3-Igh,"Ren et al., 2012",N/A pGL3-Igh-CE1_O2-4,This paper,N/A pGL3-Igh-CE1_O2-4_mO3,This paper,N/A pTO-FLAG-MED1,"Lida

Be the First to Write a Review!

pRL-CMV Vector

pRL-CMV Vector from Promega

Description

Specifications/Features

Promega

Citations (189)

Reviews

pRL-CMV Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map