psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(61) RNAi targeting LMAN1-MCFD2 complex promotes anticoagulation in miceJournal of Thrombosis and ThrombolysisSeptember 2, 2024Siqian Ma, Boyan Liu, Hong Du, Fei Yang, Jingjing Han, Xinqi Huang, Minyang Zhang, Shundong Ji, Miao Jiangbinding sites of the siRNAs were synthesized and sub-cloned into the psiCHECK-2 plasmid (Promega, USA; C8021). Cells were seeded in 96-well plate at a density of 1 × 105 cells/well. After 24 h, cells were transfected

(62) miR-449a mediated repression of the cell cycle machinery prevents neuronal apoptosisJournal of Biological ChemistrySeptember 1, 2024Monika Chauhan, Komal Singh, Chen Chongtham, Aneeshkumar A.G., Pushkar Sharmadownstream (details in Supplementary methods) of the Renilla luciferase gene in psiCHECK2 (cat. no.: C8021 from Promega) plasmid containing synthetic firefly luciferase gene (transfection control). The miRNA-binding

(63) miR-3529-3p/ABCA1 axis regulates smooth muscle cell homeostasis by enhancing inflammation via JAK2/STAT3 pathwayFrontiers in Cardiovascular MedicineAugust 27, 2024Tingyu Wang, You Yu, Yinglong Ding, Ziying Yang, Shumin Jiang, Faxiong Gao, Shan Liu, Lianbo Shao, Zhenya Shenunderscored) and a segment of mutant-type 3'UTR were cloned into a psiCHECK-2 Luciferase Vector (Promega, C8021), respectively. The recombinant plasmid (either wild or mutant type) and miR-3529 mimic were co-transfected

(64) Pan-cancer transcriptome analysis reveals widespread regulation through alternative tandem transcription initiationScience advancesJuly 12, 2024Zhao Z, Chen Y, Zou X, Lin L, Zhou X, Cheng X, Yang G, Xu Q, Gong L, Li L, et al.DNA Isolation Mini Kit (Vazyme, DC112). Renilla luciferase in psiCHECK-2 Vector (Promega, catalog no. C8021) was used as a primary reporter gene, and the 5′ UTR of interest was cloned in Nhe I–digested psiCHECK-2 Vector

(65) Sponging of five tumour suppressor miRNAs by lncRNA-KCNQ1OT1 activates BMPR1A/BMPR1B-ACVR2A/ACVR2B signalling and promotes chemoresistance in hepatocellular carcinomaCell Death DiscoveryJune 8, 2024Swagata Majumdar, Anannya Chakraborty, Sumit Das, Mahadeo Gorain, Soumyabrata Chatterjee, Indrashish Dey, Sayantani Bhowmik, Suchandrima Ghosh, Sanjana Banerjee, Sk. Mahiuddin Ahammed, et al.UCSC Genome browser, amplified by PCR and cloned in pRNAU6.1Neo vector and psiCHECKTM-2 (Promega, #C8021) vector at BamH1/HindIII and Xho1/Not1 sites respectively. Each PCR-Primer was appended with the corresponding

(66) YTHDF1’s grip on CRC vasculature: insights into LINC01106 and miR-449b-5p-VEGFA axisCancer Cell InternationalJune 4, 2024Rui-ting Ma, Yuanyuan Wang, Feng Ji, Jian-nan Chen, Tian-jun Wang, Yan Liu, Ming-xing Hou, Zhi-gang Guowild-type (WT) or mutant sequences of LINC01106 were inserted into the psiCHECK-2 plasmid (Promega, Cat#: C8021, USA). Subsequently, cells were co-transfected with the luciferase reporter plasmid and miR-449b-5p

(67) Lowering Hippocampal miR-29a Expression Slows Cognitive Decline and Reduces Beta-Amyloid Deposition in 5×FAD MiceMolecular NeurobiologyJune 1, 2024Zhen Mei, Jiaqi Liu, Jason P Schroeder, David Weinshenker, Duc M. Duong, Nicholas T. Seyfried, Yujing Li, Peng Jin, Aliza P. Wingo, Thomas S. Wingoannealed, ligated, gel purified, and cloned miR-29a sponge into 3′UTR of psiCHECK-2 vector (Promega, C8021) and pAAV-GFP vector (Cell biolabs, AAV-400), respectively. All constructs were verified by Sanger sequencing.

(68) Targeting miR‐31 represses tumourigenesis and dedifferentiation of BRAFV600E‐associated thyroid carcinomaClinical and Translational MedicineMay 26, 2024Peitao Zhang, Lizhao Guan, Wei Sun, Yu Zhang, Yaying Du, Shukai Yuan, Xiaolong Cao, Zhengquan Yu, Qiang Jia, Xiangqian Zheng, et al.3′‐untranslated region (UTR) segment and DACH1 3′‐UTR segment were cloned into the psiCHECK™‐2 vector (#C8021; Promega). For dual luciferase activity assay, HEK293T cells were transfected with wild‐type (WT) or

(69) Determinants of gastric cancer immune escape identified from non-coding immune-landscape quantitative trait lociNature CommunicationsMay 21, 2024Christos Miliotis, Yuling Ma, Xanthi-Lida Katopodi, Dimitra Karagkouni, Eleni Kanata, Kaia Mattioli, Nikolas Kalavros, Yered H. Pita-Juárez, Felipe Batalini, Varune R. Ramnarine, et al.oligo that matched the 5′ and 3′-end sequences of the XhoI-/NotI-digested psicheck2 vector (Promega, C8021) to allow cloning with the NEBuilder HiFi DNA Assembly kit (NEB, E2621S). Pool amplification and cloning Amplification

(70) Inhibitory effect of miR-377 on the proliferative and invasive behaviors of prostate cancer cells through the modulation of MYC mRNA via its interaction with BCL-2/Bax, PTEN, and CDK4Genes & CancerMay 16, 2024Yasamin Azimi, Sara Hajibabaei, Ghazal Azimi, Fatemeh Rahimi-Jamnani, Masoumeh Aziziunique scrambled sequence (AAGCTTCATAAGGCGCATAGC) were cloned into the psiCHECKTM-2 Vector (Promega, C8021) just downstream of Renilla luciferase’s stop codon. Dual-Glo Luciferase Assay System was used to conduct

(71) miRNA‑21 promotes the progression of acute liver failure via the KLF6/autophagy/IL‑23 signaling pathwayMolecular medicine reportsMay 1, 2024Bao S, Zheng W, Yan R, Xu J.was generated using a full-length of clone KLF6, which was inserted into psiCHECK™-2 Vector (cat. no. C8021; Promega Corporation). The miR-21-5p binding site found in the 3′-UTR of the KLF6 mRNA using TargetScan

(72) sRNA-Effector: a tool to expedite discovery of small RNA regulatorsiScienceMarch 15, 2024Briana Wilson, Fatemeh Esmaeili, Matthew Parsons, Wafa Salah, Zhangli Su, Anindya Duttaconstruction and assay Dual luciferase reporters were constructed on the basis of psicheck2 (Promega #C8021). miR target site (perfect complementary sequence to corresponding mature miR sequence) was inserted

(73) Quantitative proteomics of the miR-301a/SOCS3/STAT3 axis reveals underlying autism and anxiety-like behaviorMolecular Therapy - Nucleic AcidsMarch 12, 2024Xun Li, Qi Fu, Mingtian Zhong, Yihao Long, Fengyun Zhao, Yanni Huang, Zizhu Zhang, Min Wen, Kaizhao Chen, Rongqing Chen, et al.prioritization. Luciferase reporter assay The 3′UTR sequence of SOCS3 was constructed into the plasmid, psiCHECK2 (C8021, Promega, USA). HEK293T cells were transfected with psiCHECK2-SOCS3-3′UTR and pre-miR-Ctl (control)

(74) MicroRNA-561-3p indirectly regulates the PD-L1 expression by targeting ZEB1, HIF1A, and MYC genes in breast cancerSci RepMarch 10, 2024Atena Yousefi, Fattah Sotoodehnejadnematalahi, Nahid Nafissi, Sirous Zeinali, Masoumeh Azizisequence (AAGCTTCATAAGGCGCATAGC), as a negative control, were cloned into psiCHECK™-2 vector (Promega, C8021) immediately downstream of the stop codon of the renilla gene. Insertion of the PCR products into psiCHECK™-2 vector

(75) A distinct class of pan-cancer susceptibility genes revealed by an alternative polyadenylation transcriptome-wide association studyNature CommunicationsFebruary 26, 2024Hui Chen, Zeyang Wang, Lihai Gong, Qixuan Wang, Wenyan Chen, Jia Wang, Xuelian Ma, Ruofan Ding, Xing Li, Xudong Zou, et al.non-essential. Dual-luciferase reporter construction Renilla luciferase in psiCHECK-2 Vector (Promega, cat#: C8021) was used as a primary reporter gene. The firefly reporter cassette served as an intra-plasmid transfection

(76) miR-1202 acts as anti-oncomiR in myeloid leukaemia by down-modulating GATA-1S expressionOpen BiolFebruary 14, 2024Raffaele Sessa, Silvia Trombetti, Alessandra Lo Bianco, Giovanni Amendola, Rosa Catapano, Elena Cesaro, Fara Petruzziello, Maria D'Armiento, Giuseppe Maria Maruotti, Giuseppe Menna, et al.was used as positive control. 4.9. Dual luciferase reporter assay PsiCHECK-2 vectors (Promega, no. C8021), originally designed to evaluate RNA interference (RNAi) efficiency, are used as screening tool for

(77) ANGPTL4, a direct target of hsa-miR-133a-3p, accelerates lung adenocarcinoma lipid metabolism, proliferation and invasionAging (Albany NY)December 29, 2023Qihao Hu, Shi Chen, Yukun Li, Teng Hu, Jianpeng Hu, Cheng Wang, Fei Yang, Xiang Yang, Feng Zhou, Zhengdong Liu, et al.psiCheck2 Luciferase vector (Promega Corporation, USA). We purchased the psiCHECK2 vector (cat. no. C8021) from Promega. We synthesized the miR-133a-3p mimics, negative control samples (NCs), and miR-133a-3p

(78) miR-23b-3p Ameliorates LPS-Induced Pulmonary Fibrosis by Inhibiting EndMT via DPP4 InhibitionMolecular BiotechnologyDecember 27, 2023Linlin Yue, Feng Chen, Xin Liu, Chaoyu Wu, Jie Wang, Jiying Lai, Hongquan Zhucontaining the wild-type or mutant binding site of hsa-miR-23b-3p were subcloned into the psiCHECK2 vector (C8021, Promega). psiCHECK2 plasmid containing the insertion sequence and hsa-miR-23b-3p mimic/mimic-negative

(79) Identification of Tumor-Suppressive miR-139-3p-Regulated Genes: TRIP13 as a Therapeutic Target in Lung AdenocarcinomaCancers (Basel)November 24, 2023Yoko Hagihara, Yuya Tomioka, Takayuki Suetsugu, Masahiro Shinmura, Shunsuke Misono, Yusuke Goto, Naoko Kikkawa, Mayuko Kato, Hiromasa Inoue, Keiko Mizuno, et al.directly to the 3′UTR of the TRIP13 gene. The miR-139-3p-binding sequence cloned into the psiCHEK2 vector (C8021; Promega, Madison, WI, USA) is shown in Figure S1. The dual-luciferase reporter assay procedure was

(80) Identification of miR-128 Target mRNAs That Are Expressed in B Cells Using a Modified Dual Luciferase VectorBiomoleculesOctober 13, 2023Sandra Schreiber, Patrick Daum, Heike Danzer, Manuela Hauke, Hans-Martin Jäck, Jürgen Wittmannenzyme-compatible dual luciferase vectors for pRL-TK (Promega), the psiCHECK-2 vector (Promega, Cat. No. C8021) was modified as follows: first, the vector was cleaved at the XbaI site downstream of the Firefly luciferase

Be the First to Write a Review!