ProtoScript II First Strand cDNA Synthesis Kit E6560L from New England Biolabs

Product Specs
ItemProtoScript II First Strand cDNA Synthesis Kit
CompanyNew England Biolabs
Price $737.00 Inquire
Catalog NumberE6560L
Quantity150 reactions
ApplicationsDNA Analysis
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Photobiomodulation With 976 nm Diode Laser Enhances Osteoblastic Differentiation of Saos-2 Cells Cultured on Collagen MembranesClin Exp Dent ResApril 28, 2026Escobar Lina M., Bendahan Zita, Pinzón Paula, Grajales Marggie, Baldion Paulasynthesized by reverse transcription using the ProtoScript II First Strand cDNA Synthesis Kit (Ref. #E6560L, New England BioLabs, Ipswich, MA, USA). Briefly, RNA sample (final concentration 200 μg/μL) were denatured

(2) Dual role of ZIC2 during neural induction: from priming transcription factor to enhancer activatorNucleic Acids ResApril 25, 2026María Mariner-Faulí, Víctor Sánchez-Gaya, Sarah Malika Robert, Patricia Respuela, Sara de la Cruz-Molina, Sara Lobato-Moreno, Matteo Trovato, Karin D Prummel, Kyung-Min Noh, Judith B Zaugg, et al.complementary DNA (cDNA) using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560L) using oligo-dT primers to ensure selective reverse transcription of mRNA. RT-qPCR, ChIP-qPCR, and

(3) ACRC/GCNA is an essential protease that repairs DNA-protein crosslinks during vertebrate developmentNucleic Acids ResApril 20, 2026Cecile Otten, Marin Kutnjak, Christine Supina-Pavic, Marija Pranjic, Ivan Anticevic, Vanna Medved, Marta Popovicpurified total RNA was reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit (#E6560, NEB) and a 1:1 mix of oligodT and random hexamer primers to obtain cDNA. Quantification of zebrafish

(4) A region-delineated snRNA-seq atlas of mouse spinal cord across lifespan resolves the interaction of normative aging programs with SOD1-G93A ALSbioRxivApril 11, 2026Michael Edison Pauli Ramos, Brijesh Kumar Singh, Oksana Shelest, Ian Tindel, Benisa Zogu, Ashley Dawson, Pranav Mathkar, Shaughn Bell, Ritchie HocDNA synthesis was performed using NEB Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs, Cat# E6560L). qPCR was performed using SYBR Green chemistry (Applied Biosciences, Cat# 4309155) in a Bio-Rad CFX384

(5) Clinical Evaluation of Three KRS Families and Cellular Analysis of Distinct ATP13A2 Mutations Reveal Different Levels of Iron AccumulationJ NeurochemApril 7, 2026Ezgi Erterek, Benan Temizci, Şeyma Tekgül, Bilal Çakır, A. Nazlı Başak, Murat Gültekin, Zuhal Yapıcı, Arzu Karabaymix and ProtoScript II First Strand cDNA Synthesis kit (New England Biolabs, Ipswich, MA, USA Cat# E6560). Obtained cDNAs were used for real‐time PCR. Human ATP13A2 primers (Forward: 5′‐CATACCGGTCAAGTCCTACCC‐3′

(6) Receptor-guided AAV Tropism Engineering via MATCHbioRxivApril 1, 2026Nolan Graham, Satheesh Kumar, Joseph Rainaldi, Seoin Yang, Andrew Portell, Billy Santoso, Prashant Malifrom extracted RNA using the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, E6560), as per the manufacturer’s instructions. DNA was extracted from C57BL/6J mouse tissues using Qiagen

(7) ADH1C Down-Regulation Is a Key Hypoxia Response in Colon EpitheliumThe American Journal of PathologyApril 1, 2026Maged Zeineldin, Tianhao Bi, Varuni Rastogi, Yi Dong, Reem Abu-Shamma, Tatianna C. LarmanBriefly, ADH1C cDNA was amplified from H3 colonoids using the ProtoScript II kit (NEB, Ipswich, MA; number E6560) following the manufacturer's instructions (oligo-dT primers and 1 μg of total RNA). ADH1C cDNA was

(8) Impaired neutralizing antibody responses against the BA1.1, BA.2, and BA.5 Omicron SARS-CoV-2 subvariants in hospitalized adults infected with pre-Omicron variants in ArgentinaMicrobiology SpectrumMarch 3, 2026J. Sachithanandham, I. A. Sitaras, R. A. Albertini, R. H. Capra, J. Marquez, G. B. Sadino-Vallve, P. R. Gargantini, P. R. Cortes, N. E. Ponce, A. van de Guchte, et al.underwent complementary DNA synthesis with random hexamers using ProtoScript II (New England Biolabs, E6560), followed by whole-genome amplification with custom-designed tiling primers. Library preparation was

(9) Reduced Sphingosine-1-Phosphate Levels Exacerbate Type 2 Diabetes Mellitus and Associated Complications in a High-Fat Diet Mouse ModelEndocrinology and MetabolismFebruary 28, 2026Shih-Chang Hsu, Ching-Lu Chen, Chung Te Liu, Hung-Chieh Lo, Ying-Kuo Liu, Pei-Song Gao, Shau-Ku Huang, Chin-Wang Hsutotal RNA was reverse-transcribed into cDNA using the ProtoScript® First Strand cDNA Synthesis Kit (#E6560L; New England Biolabs). Quantitative real-time PCR (qRT-PCR) was performed using Fast SYBRTM Green Master

(10) Massively parallel reporter assay for mapping gene-specific regulatory regions at single-nucleotide resolutioneLifeFebruary 25, 2026Alastair J Tulloch, Ryan Nicholas Delgado, Rinaldo Catta-Preta, Constance L Cepkobarcode abundance in RNA, polyA RNA was reverse-transcribed using the Protoscript II Kit (NEB, cat. #E6560) and a reverse transcription primer at 1µM specific to all barcoded transcripts (bc7_cdnaR; Supplementary

(11) Advancing knock-in approaches for robust genome editing in zebrafishBiology OpenFebruary 15, 2026Anjelica Rodriguez-Parks, Ella Grace Beezley, Steffani Manna, Isabella Silaban, Sarah I. Almutawa, Siyang Cao, Hossam Ahmed, Megan Guyer, Sean Baker, Mark P. Richards, et al.synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). Primer sequences used for RT-PCR are listed in Data File 1. Subcloning and transgenesis mini-golden

(12) HIV-1 and HIV-2 interaction results in reduced cell infectivity and viral replication in vitroVirology JournalFebruary 10, 2026Edwin Magomere, Mark Appeaning, Nana-Ama Amoako, Alberta Serwah, Kirk Kouffie, Enoch Matey Langmer, Samuel Effah, Thibault Mesplede, George B. Kyei, Thumbi Ndung’u, et al.transcribed to cDNA using ProtoScript® II First Strand cDNA synthesis kit (New England Biolabs), Cat# E6560S, following manufacturer’s instructions [38]. Briefly, reverse transcription was performed using random

(13) A common 19 bp APOE enhancer deletion is protective against Alzheimer’s disease in African AmericansNature CommunicationsFebruary 2, 2026Julianna N. Brutman, Tina Busald, Evangelos Nizamis, Eli J. Kaufman, Eugene Lin, Nzinga E. Hendricks, Sana Chintamen, Arvis Sulovari, Samuel N. Smukowski, Yidian Ye, et al.downstream analysis. RNA was reverse transcribed into cDNA using the First Strand cDNA Synthesis (NEB, E6560) kit. Briefly, 100 ng of RNA was converted into cDNA using the “Easy Protocol” with d(T)23 VN. For RT-qPCR,

(14) Chromatin modifiers KMT2D, BAF, and p300 are required for de novo binding of transcription factors on enhancersbioRxivFebruary 1, 2026Hieu T. Van, Young-Kwon Park, Chengyu Liu, Shamima Islam, Stefania Dell’Orso, Weiqun Peng, Vittorio Sartorelli, Ji-Eun Lee, Kai Ge(#15596018, Invitrogen) and reverse transcribed using ProtoScript II first-strand cDNA synthesis kit (#E6560, NEB), following manufacturer’s instructions. Quantitative RT-PCR (qRT-PCR) was performed in triplicates

(15) Mining Differentially Expressed Genes in the Marine Free-Living Flatworm Macrostomum lignano Under Aneuploidy-Driven Ploidy ChangesCellsJanuary 27, 2026Kira S. Zadesenets, Nikita I. Ershov, Natalya P. Bondar, Konstantin E. Orishchenko, Nikolay B. Rubtsovwas reverse transcribed using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, E6560S), according to the manufacturer’s instructions. The transcript abundance was measured using the Bio-Rad

(16) Fibrin barriers limit vancomycin penetration into staphylococcal abscess communities and maintain S. aureus in an unstressed, transcriptionally-responsive statebioRxivJanuary 24, 2026Parsa Alba Farhang, Timothy Huang, Rezia Era D. Braza, Anjali Anil, Kimberly M. Davisgenerate cDNA, the ProtoScript II First Strand cDNA Synthesis Kit was used (New England Biolabs, cat no. E6560S). Resulting cDNA was diluted in 80μL nuclease-free water and stored at −20°C. For the qPCR reactions,

(17) SMARCA4 loss promotes late-stage tumor progression in non-neuroendocrine small-cell lung cancerMolecular Cancer ResearchJanuary 16, 2026Nicole A. Kirk, Jin Ng, Kate-Lin Ly, Miae Choi, Young Ho Ban, Godfrey A. Dzhivhuho, Jinho Jang, Kyung-Pil Ko, Michael S. Kareta, Jae-Il Park, et al.protocol. cDNA was generated by the ProtoScript II First-Strand cDNA Synthesis Kit (New England Biolabs, E6560). RT-qPCR was performed using SYBR Green (Thermo Fisher Scientific, 4367659) with Applied Biosystems

(18) Lysophosphatidic Acid Synergizes With 1,25‐Dihydroxyvitamin D to Promote Fibroblast Growth Factor‐23 Synthesis via MAPK Signaling and Induction of the IL12A GeneThe FASEB JournalJanuary 15, 2026Birol Ay, Sajin Marcus Cyr, Yorihiro Iwasaki, Elizabeth Hill, Eugene P. Rhee, Nevil J. Singh, Petra Simic, Murat Bastepeusing the RNeasy Mini Kit (74 104, Qiagen) and converted into cDNA using a first‐strand synthesis kit (E6560, New England BioLabs). cDNAs used to detect Fgf23 gene expression were prepared with oligo(dT) and a

(19) TGFβ1 attenuates microglial IL1β release through inhibition of NLRP3 inflammasome primingFrontiers in ImmunologyJanuary 5, 2026Christopher Kalischer, Phani Sankar Potru, Nele Lehmann, Jannik Jahn, Nikolai Leander Rupp, Natascha Vidovic, Tamara Russ, Susanne Wiemann, Björn Spittaueach sample was reverse transcribed to cDNA using Protoscript® II First Strand cDNA Synthesis Kit (#E6560S, New England Biolabs, Frankfurt, Germany) according to the manufacturer’s instructions. 2.5 Quantitative

(20) The Role of Aurora Kinase A in HBV-Associated Hepatocellular Carcinomas: A Molecular and Immunohistochemical StudyDiagnostics (Basel)January 4, 2026Mustafa Huz, Nese Karadag Soylu, Ahmet Koc, Zeynep Kucukakcali, Nefsun Danis, Onural OzhanDespite this, cDNA synthesis proceeded using the ProtoScript First Strand cDNA Synthesis Kit (Cat. No: E6560S, New England Biolabs, Ipswich, MA, USA). For CNV analysis, 8 µm sections were obtained from FFPE tissue

Be the First to Write a Review!

ProtoScript II First Strand cDNA Synthesis Kit

ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs

New England Biolabs

Citations (264)

Reviews

ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map