ProtoScript II First Strand cDNA Synthesis Kit E6560L from New England Biolabs

Product Specs
ItemProtoScript II First Strand cDNA Synthesis Kit
CompanyNew England Biolabs
Price $737.00 Inquire
Catalog NumberE6560L
Quantity150 reactions
ApplicationsDNA Analysis
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(21) Mining Differentially Expressed Genes in the Marine Free-Living Flatworm Macrostomum lignano Under Aneuploidy-Driven Ploidy ChangesCellsJanuary 27, 2026Kira S. Zadesenets, Nikita I. Ershov, Natalya P. Bondar, Konstantin E. Orishchenko, Nikolay B. Rubtsovwas reverse transcribed using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, E6560S), according to the manufacturer’s instructions. The transcript abundance was measured using the Bio-Rad

(22) Fibrin barriers limit vancomycin penetration into staphylococcal abscess communities and maintain S. aureus in an unstressed, transcriptionally-responsive statebioRxivJanuary 24, 2026Parsa Alba Farhang, Timothy Huang, Rezia Era D. Braza, Anjali Anil, Kimberly M. Davisgenerate cDNA, the ProtoScript II First Strand cDNA Synthesis Kit was used (New England Biolabs, cat no. E6560S). Resulting cDNA was diluted in 80μL nuclease-free water and stored at −20°C. For the qPCR reactions,

(23) SMARCA4 loss promotes late-stage tumor progression in non-neuroendocrine small-cell lung cancerMolecular Cancer ResearchJanuary 16, 2026Nicole A. Kirk, Jin Ng, Kate-Lin Ly, Miae Choi, Young Ho Ban, Godfrey A. Dzhivhuho, Jinho Jang, Kyung-Pil Ko, Michael S. Kareta, Jae-Il Park, et al.protocol. cDNA was generated by the ProtoScript II First-Strand cDNA Synthesis Kit (New England Biolabs, E6560). RT-qPCR was performed using SYBR Green (Thermo Fisher Scientific, 4367659) with Applied Biosystems

(24) Lysophosphatidic Acid Synergizes With 1,25‐Dihydroxyvitamin D to Promote Fibroblast Growth Factor‐23 Synthesis via MAPK Signaling and Induction of the IL12A GeneThe FASEB JournalJanuary 15, 2026Birol Ay, Sajin Marcus Cyr, Yorihiro Iwasaki, Elizabeth Hill, Eugene P. Rhee, Nevil J. Singh, Petra Simic, Murat Bastepeusing the RNeasy Mini Kit (74 104, Qiagen) and converted into cDNA using a first‐strand synthesis kit (E6560, New England BioLabs). cDNAs used to detect Fgf23 gene expression were prepared with oligo(dT) and a

(25) Lysophosphatidic Acid Synergizes With 1,25‐Dihydroxyvitamin D to Promote Fibroblast Growth Factor‐23 Synthesis via MAPK Signaling and Induction of the IL12A GeneFASEB JJanuary 9, 2026Birol Ay, Sajin Marcus Cyr, Yorihiro Iwasaki, Elizabeth Hill, Eugene P. Rhee, Nevil J. Singh, Petra Simic, Murat Bastepeusing the RNeasy Mini Kit (74 104, Qiagen) and converted into cDNA using a first‐strand synthesis kit (E6560, New England BioLabs). cDNAs used to detect Fgf23 gene expression were prepared with oligo(dT) and a

(26) TGFβ1 attenuates microglial IL1β release through inhibition of NLRP3 inflammasome primingFrontiers in ImmunologyJanuary 5, 2026Christopher Kalischer, Phani Sankar Potru, Nele Lehmann, Jannik Jahn, Nikolai Leander Rupp, Natascha Vidovic, Tamara Russ, Susanne Wiemann, Björn Spittaueach sample was reverse transcribed to cDNA using Protoscript® II First Strand cDNA Synthesis Kit (#E6560S, New England Biolabs, Frankfurt, Germany) according to the manufacturer’s instructions. 2.5 Quantitative

(27) The Role of Aurora Kinase A in HBV-Associated Hepatocellular Carcinomas: A Molecular and Immunohistochemical StudyDiagnostics (Basel)January 4, 2026Mustafa Huz, Nese Karadag Soylu, Ahmet Koc, Zeynep Kucukakcali, Nefsun Danis, Onural OzhanDespite this, cDNA synthesis proceeded using the ProtoScript First Strand cDNA Synthesis Kit (Cat. No: E6560S, New England Biolabs, Ipswich, MA, USA). For CNV analysis, 8 µm sections were obtained from FFPE tissue

(28) Activation of Intestinal Mast Cells Contributes to Gut Damage After Cardiac Arrest in MiceShockJanuary 1, 2026Lihong Dang, Ata Ur Rehman, Jin Zhang, Ran Zhang, Xinyuan Yu, Huaxin Sheng, Jörn Karhausen, Wei YangUSA), and cDNA was obtained using ProtoScript II first strand cDNA Synthesis Kit (New England Biolabs; E6560), both according to the manufacturer’s instructions. Quantitative PCR was performed using iTaq Universal

(29) A computational framework to study EGFR signaling distribution in egg chambers during dynamic interactions between soma and germlinePLOS Computational BiologyDecember 29, 2025Nastassia Pouradier Duteil, Nicole T. Revaitis, Mathew G. Niepielko, Eric A. Klein, Nir Yakoby, Benedetto Piccoliremove genomic DNA contamination. RT was performed with random hexamers using NEB protoscript II kit (E6560) and followed manufacturer’s instructions with 1 µg total RNA per reaction. No RT controls were performed

(30) Regulatable In Vivo Gene Expression via AdaptamersbioRxivDecember 24, 2025Jack Bryant, Laura Herron, Yesh Doctor, Finn McRae, Jocelyn Wang, Theodore Hirsch, Andrew Portell, Satheesh Kumar, Prashant MaliRNAeasy Mini Kit. cDNA was generated using the Protoscript® II First Strand cDNA Synthesis Kit (NEB E6560L). The adaptamer sequence was amplified using primers 3xFlag_F: 5’GACTACAAAGACCACGACGGGGAC3’ and P2A_R:

(31) A cell-state axis underlying colonization in carcinomas with implications for metastasis risk prediction and interceptionCell ReportsDecember 23, 2025Jesse S. Handler, Zijie Li, Rachel K. Dveirin, Jessica D. Lin, Weixiang Fang, Shihan Wu, James E. Forsmo, Hani Goodarzi, Elana J. Fertig, Reza Kalhor"Tumor Dissociation Kit, mouse",Miltenyi,130-096-730 ProtoScript II First Strand cDNA Synthesis Kit,New England Biolabs,E6560S Forget-Me-Not EvaGreen qPCR Master Mix,Biotium,31045 Critical commercial assays,Critical commercial

(32) SS18::SSX and BRD9 Modulate Synovial Sarcoma DifferentiationCellsDecember 18, 2025Anna Kuntze, Victor Banerjee, Marcel Trautmann, Charlotte Pünt, Ruth Berthold, Pascal Hauser, Lucas Scholl, Eva Wardelmann, Kornelius Kerl, Wolfgang Hartmann, et al.Afterwards, cDNA synthesis with the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560; Ipswich, MA, USA) was performed, according to the manufacturer’s instructions. The cDNA quality was

(33) Advancing Knock-In Approaches for Robust Genome Editing in ZebrafishbioRxivDecember 12, 2025Anjelica Rodriguez-Parks, Ella Grace Beezley, Steffani Manna, Isabella Silaban, Sarah I Almutawa, Siyang Cao, Hossam Ahmed, Megan Guyer, Sean Baker, Mark P Richards, et al.synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). Primer sequences used for RT-PCR are listed in Supplementary Data File 1. Subcloning and transgenesis mini-golden

(34) Processed Transcript Insertion as a Novel Germline Mutational Mechanism in BRCA1-Associated Hereditary Breast CancerCancers (Basel)December 2, 2025Anikó Bozsik, Henriett Butz, Vince Kornél Grolmusz, Petra Nagy, Tímea Pócza, Erika Tóth, Erzsébet Csernák, Attila Patócs, János PappFirst-strand reverse transcription was carried out by ProtoScript II Reverse Transcriptase (cat. no. E6560, New England Biolabs, Ipswich, MA, USA). cDNA primers were designed by Primer3Plus (https://www.primer3plus.com,

(35) rbfox1 LoF mutants show disrupted bdnf/trkb2 and crhb/nr3c2 expression and increased cortisol levels during development coupled with signs of allostatic overload in adulthoodTranslational PsychiatryNovember 19, 2025Adele Leggieri, Judit García-González, Saeedeh Hosseinian, Peter Ashdown, Sofia Anagianni, Xian Wang, William Havelange, Noèlia Fernàndez-Castillo, Bru Cormand, Caroline H. Brennantranscribed to cDNA using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, #E6560) following manufacturer’s instructions. The resulting cDNA yield and quality were evaluated using BioDrop

(36) The blood–brain barrier regulates brain tumor growth through the SLC36 amino acid transporter Pathetic in DrosophilaPLOS BiologyNovember 18, 2025Qian Dong, Edel Alvarez-Ochoa, Phuong-Khanh Nguyen, Paul Orih, Natasha Fahey-Lozano, Hina Kosakamoto, Fumiaki Obata, Cyrille Alexandre, Louise Y. Chengfollowed by reverse transcription into cDNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB, #E6560S) according to the manufacturer’s instructions. 3 biological replicates were prepared for each condition

(37) Local nuclear to cytoplasmic ratio regulates H3.3 incorporation via cell cycle state during zygotic genome activationEMBO ReportsNovember 11, 2025Anusha D Bhatt, Madeleine G Brown, Aurora B Wackford, Yuki Shindo, Amanda A AmodeoProtoScript First Strand cDNA Synthesis Kit following the manufacturer’s protocol (New England Biolabs, E6560L). RT-qPCRs were performed on a StepOnePlus RT-PCR machine (4376600) using the TaqMan GEX master mix

(38) Mucus-derived glycans are inhibitory signals for Salmonella Typhimurium SPI-1-mediated invasionCell ReportsOctober 28, 2025Kelsey M. Wheeler, Michaela A. Gold, Corey A. Stevens, Karsten Tedin, Amanda M. Wood, Deniz Uzun, Gerardo Cárcamo-Oyarce, Bradley S. Turner, Marcus Fulde, Jeongmin Song, et al.RNA Purification Kit,Biosearch Technologies,Cat# MC85200Lot# 34146 ProtoScript II First Strand cDNA Synthesis kit,NEB,Cat# E6560L Turbo DNA-Free Kit,Invitrogen,Cat# AM1907 SYBR PowerUp Master Mix,Applied Biosystems,Cat# A25778 NEBNext

(39) Loss of CFIm activates YAP/TAZ and connects mRNA cleavage and polyadenylation inhibition to BRCAnessbioRxivOctober 24, 2025Madeleine Goldthorpe, Jiahui Hou, Abhi Nadendla, Hatice Ulku Osmanbeyoglu, Hun-Way HwangBiolabs,Cat#C3040, Commercial assay or kit,ProtoScript II First Strand cDNA Synthesis Kit,New England Biolabs,Cat#E6560, Commercial assay or kit,Q5 High Fidelity DNA Polymerase,New England Biolabs,Cat#M0491, Commercial

(40) Enhancing cross-organelle coordination to advance plant cytochrome P450 functionality in yeastSci AdvOctober 24, 2025Shanhui Xu, Songbo Wei, Yun Xiong, Xiaoxuan Teng, Kyle Sipe, Alair Abad, Theo Poucet, Yinsheng Wang, Yanran Liwas obtained by using the ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs (E6560S) according to the manufacturer’s protocols. qRT-PCR was conducted by using SsoAdvanced Universal SYBR Green Supermix

Be the First to Write a Review!

ProtoScript II First Strand cDNA Synthesis Kit

ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs

New England Biolabs

Citations (285)

Reviews

ProtoScript II First Strand cDNA Synthesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map