GoScript Reverse Transcriptase from Promega

Product Specs
ItemGoScript Reverse Transcriptase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA5003
Quantity100 reactions

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(61) SET7/9-mediated methylation affects oncogenic functions of histone demethylase JMJD2AJCI insightOctober 23, 2023Gu R, Kim TD, Song H, Sui Y, Shin S, Oh S, Janknecht R.gene expression. For RT-PCR, RNA was reverse-transcribed with the GoScript Reverse Transcription System (catalog A5004; Promega) using p(dN)6 primers and then amplified by PCR according to standard procedures (78). Relative

(62) Cell-type-specific control of secondary cell wall formation by Musashi-type translational regulators in ArabidopsisElifeSeptember 29, 2023Alicia Kairouani, Dominique Pontier, Claire Picart, Fabien Mounet, Yves Martinez, Lucie Le-Bot, Mathieu Fanuel, Philippe Hammann, Lucid Belmudes, Remy Merret, et al.were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20 μl final volume reaction using random primers (Cat. No. C1181; Promega) in the presence

(63) Cell-type-specific control of secondary cell wall formation by Musashi-type translational regulators in ArabidopsiseLifeSeptember 29, 2023Alicia Kairouani, Dominique Pontier, Claire Picart, Fabien Mounet, Yves Martinez, Lucie Le-Bot, Mathieu Fanuel, Philippe Hammann, Lucid Belmudes, Remy Merret, et al.were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20 μl final volume reaction using random primers (Cat. No. C1181; Promega) in the presence

(64) The Tyrosine Phosphatase Activity of PTPN22 Is Involved in T Cell Development via the Regulation of TCR ExpressionInternational journal of molecular sciencesSeptember 25, 2023Bai B, Li T, Zhao J, Zhao Y, Zhang X, Wang T, Zhang N, Wang X, Ba X, Xu J, et al.reverse transcribed to cDNA using the GoScript™ Reverse Transcriptase Kit (Promega, Madison, WI, USA, A5003), and the gene expression levels were analyzed using GoTaq® qPCR Master Mix (Promega, A6001) and reacted

(65) Jaw Bone Invasion of Oral Squamous Cell Carcinoma Is Associated with Osteoclast Count and Expression of Its Regulating Proteins in Patients and OrganoidsJournal of clinical medicineSeptember 18, 2023de Kort WWB, Haakma WE, van Es RJJ, Gawlitta D, Driehuis E, Gansevoort M, Willems SM.in water for 5 min at 70 °C. To generate cDNA, GoScript Reverse Transcriptase (Promega, catalog no. A5003) was used according to protocol. qPCR reactions were performed in 384-well format using IQ SYBR green

(66) Mobilisation of jerboa kidney gene networks during dehydration and opportunistic rehydrationiScienceSeptember 15, 2023Benjamin T. Gillard, Nabil Amor, Fernando Alvira Iraizoz, Audrys G. Pauža, Colin Campbell, Michael P. Greenwood, Abdulaziz N. Alagaili, David Murphymale and female animals. Total RNA (2μg) was converted to cDNA using GoScript Reverse Transcriptase (A5003, Promega) as per the manufacturer’s instructions. Primers were designed using Primer-BLAST64 targeting

(67) Diesel Exhaust Particle (DEP)-induced glucose intolerance is driven by an intestinal innate immune response and NLRP3 activation in miceParticle and Fibre ToxicologyJuly 3, 2023Angela J. T. Bosch, Theresa V. Rohm, Shefaa AlAsfoor, Andy J. Y. Low, Zora Baumann, Neena Parayil, Faiza Noreen, Julien Roux, Daniel T. Meier, Claudia Cavelti-WederUniversal Mini kit (Cat# 73,404, QIAGEN). Reverse transcription was performed with GoScript™ (Cat# A5003, Promega). GoTaq qPCR Master Mix (Cat# A4472919, Promega) was used for real-time PCR (ViiA7, Thermo

(68) Next Generation Exon 51 Skipping Antisense Oligonucleotides for Duchenne Muscular DystrophyNucleic Acid TherapeuticsJune 1, 2023Judith van Deutekom, Chantal Beekman, Suzanne Bijl, Sieto Bosgra, Rani van den Eijnde, Dennis Franken, Bas Groenendaal, Bouchra Harquouli, Anneke Janson, Paul Koevoets, et al.1,000 ng of total RNA with 3.2 μg random hexamer primers (No. 11034731001; Roche) and GoScript (No. A5003; Promega), according to the manufacturer's instructions. Protein lysates were prepared by adding 75

(69) CRISPR-Cas9 screen reveals a role of purine synthesis for estrogen receptor α activity and tamoxifen resistance of breast cancer cellsScience AdvancesMay 12, 2023Dina Hany, Vasiliki Vafeiadou, Didier PicardcDNA using random primers (Promega, no. C1181) and a GoScript reverse transcriptase kit (Promega, no. A5003). Quantitative real-time PCR (qPCR) reactions were done using specific primers and a GoTaq qPCR Master Mix

(70) CRISPR/Cas9-Mediated Knockout of tnfaip1 in Zebrafish Plays a Role in Early DevelopmentGenesApril 28, 2023Huang S, Zhang H, Chen W, Su N, Yuan C, Zhang J, Xiang S, Hu X.Takara, Okinawa, Japan). cDNA was, subsequently, synthesized using GoScript™ reverse transcriptase (A5003, Promega, Madison, WI, USA). In this study, 18SrRNA was used as an internal reference gene used for

(71) Extending the toolbox for RNA biology with SegModTeX: A polymerase-driven method for site-specific and segmental labeling of RNAResearch SquareApril 26, 2023Raphael Haslecker, Vincent V. Pham, David Glänzer, Christoph Kreutz, Theodore Kwaku Dayie, Victoria M. D'Souzashort (25 nt) primer (5′TCCATGACTCATGAACAAGAGACCC3′) using GoScript™ Reverse Transcriptase (Promega A5003). PCR amplification of the RT product was done with EconoTaq® PLUS (LGC Biosearch Technologies #300331)

(72) Disruption of the ABA1 encoding zeaxanthin epoxidase caused defective suberin layers in Arabidopsis seed coatsFrontiers in Plant ScienceMarch 15, 2023Jeongho Choi, Hyojin Kim, Mi Chung Suhisolated total RNA was used to synthesize complementary DNA using GoScript Reverse Transcriptase (Promega, A5003), following the manufacturer’s instructions. The obtained cDNA was used for RT-PCR and RT-qPCR analyses.

(73) Lung versus gut exposure to air pollution particles differentially affect metabolic health in miceParticle and Fibre ToxicologyMarch 9, 2023Angela J. T. Bosch, Theresa V. Rohm, Shefaa AlAsfoor, Andy J. Y. Low, Lena Keller, Zora Baumann, Neena Parayil, Marc Stawiski, Leila Rachid, Thomas Dervos, et al.Plus Universal Mini kit (Cat# 73404, QIAGEN). Reverse transcription was performed with GoScript™ (Cat# A5003, Promega). GoTaq qPCR Master Mix (Cat# A4472919, Promega) was used for real-time PCR (ViiA7, Thermo

(74) Network-informed discovery of multidrug combinations for ERα+/HER2-/PI3Kα-mutant breast cancerCellular and Molecular Life SciencesMarch 3, 2023Dina Hany, Marloes Zoetemelk, Kaushik Bhattacharya, Patrycja Nowak-Sliwinska, Didier Picard400 ng total RNA, random primers (Promega #C1181), and GoScript reverse transcriptase kit (Promega #A5003). Then, GoTaq qPCR Master Mix kit (Promega #A6001) and specific primers were used to set up the quantitative real-time PCR

(75) Polarized Anti-Inflammatory Mesenchymal Stem Cells Increase Hippocampal Neurogenesis and Improve Cognitive Function in Aged MiceInternational journal of molecular sciencesFebruary 24, 2023Tfilin M, Gobshtis N, Fozailoff D, Fraifeld VE, Turgeman G.of total RNA was reverse transcribed using GoScript™ Reverse Transcription System (Promega, cat No. A5003). After reverse transcription, real-time PCR analysis by real-time PCR QuantStudioTM machine was conducted

(76) The aryl hydrocarbon receptor cell intrinsically promotes resident memory CD8(+) T cell differentiation and functionCell reportsJanuary 31, 2023Dean JW, Helm EY, Fu Z, Xiong L, Sun N, Oliff KN, Muehlbauer M, Avram D, Zhou L.Kit,Takara,Cat# 634456 iDeal ChIP-Seq,Diagenode,Cat# C01010055 GoScript Reverse Transcriptase,Promega,Cat# A5003 Zombie Aqua Fixable Viability Kit,BioLegend,Cat# 423102 Live and Dead Violet Viability Kit,Invitrogen,Cat#

(77) Vacuole Membrane Protein 1 (VMP1) Restricts NLRP3 Inflammasome Activation by Modulating SERCA Activity and AutophagyResearch squareJanuary 27, 2023Zack SR, Nikolaienko R, Cook B, Melki R, Zima AV, Campbell EM.(Macherey-Nagel, 740984.250). cDNA was synthesized using the GoScript Reverse Transcriptase System (Promega, A5004). Quantitative PCR was performed using gene specific primers and Itaq™ Universal SYBR (Bio-Rad, 1725124).

(78) Unique expression of the atypical mitochondrial subunit NDUFA4L2 in cerebral pericytes fine tunes HIF activity in response to hypoxiaJournal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and MetabolismJanuary 1, 2023Mesa-Ciller C, Turiel G, Guajardo-Grence A, Lopez-Rodriguez AB, Egea J, De Bock K, Aragonés J, Urrutia AA.µg RNA was then reverse – transcribed for cDNA synthesis using GoScript™ Reverse Transcriptase Kit (A5004, Promega, Madison, WI, USA). PCR amplifications were then performed using the SYBR™ Power SYBR™ Green PCR Master Mix

(79) Suppression of YAP safeguards human naïve pluripotencyDevelopmentDecember 15, 2022Anish Dattani, Tao Huang, Corin Liddle, Austin Smith, Ge Guoa ReliaPrep kit (Promega, Z6012) and cDNA synthesised with GoScript reverse transcriptase (Promega, A5004) and 3′Race (oligo dT) adaptor primers. TaqMan assays (Thermo Fisher Scientific) and Universal Probe

(80) Multi-hallmark long noncoding RNA maps reveal non-small cell lung cancer vulnerabilitiesCell GenomSeptember 14, 2022Esposito R, Polidori T, Meise DF, Pulido-Quetglas C, Chouvardas P, Forster S, Schaerer P, Kobel A, Schlatter J, Kerkhof E, et al.reverse transcribed to produce cDNAs by using the GoScript Reverse Transcription System Kit (Promega #A5003). The cDNAs were then used for qPCR to evaluate gene expression, using the GoTaq qPCR Master Mix kit

Be the First to Write a Review!