GoScript Reverse Transcriptase from Promega

Product Specs
ItemGoScript Reverse Transcriptase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA5003
Quantity100 reactions

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(41) Identification and Comprehensive Analysis of OFP Genes for Fruit Shape Influence in MangoGenes (Basel)June 21, 2024Qiuping Wu, Rui Xia, Jie Yang, Rong Chen, Zaohai Zeng, Chao FanFirst-strand cDNA was synthesized from 1 μg total RNA using the GoScript Reverse Transcriptase (Promega, A5003). Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was performed using THUNDERBIRD

(42) hnRNPM protects against the dsRNA-mediated interferon response by repressing LINE-associated cryptic splicingMolecular CellJune 6, 2024Rong Zheng, Mikayla Dunlap, Georg O.M. Bobkov, Carlos Gonzalez-Figueroa, Khushali J. Patel, Jingyi Lyu, Samuel E. Harvey, Tracey W. Chan, Giovanni Quinones-Valdez, Mudra Choudhury, et al.cDNA was generated via reverse transcription using the GoScript Reverse Transcription System (Promega, A5004) with 1 ul GoScript RT and 250 ng of RNA in a total volume of 20ul followed by incubation at 25 °C for

(43) Xrp1 governs the stress response program to spliceosome dysfunctionNucleic Acids ResearchMarch 21, 2024Dimitrije Stanković, Luke S Tain, Mirka Uhlirovaretention assay cDNA was synthesized from 2 μg of total RNA using GoScript Reverse Transcriptase (Promega #A5003) with random hexamers according to the manufacturer’s protocol. Quantitative polymerase chain reaction (PCR

(44) Overexpression of NtGPX8a Improved Cadmium Accumulation and Tolerance in Tobacco (Nicotiana tabacum L.)Genes (Basel)March 15, 2024Xiang Peng, Tengfei Ma, Kejin Song, Xue Ji, Lien Xiang, Nan Chen, Ronglei Zu, Wenyi Xu, Shunqin Zhu, Wanhong Liufirst-strand cDNA synthesis was carried out using the GoScriptTM Reverse Transcription System (No. A5003, Promega, Madison, WI, USA). The synthesized cDNA was utilized for subsequent qPCR analysis. The qPCR

(45) Impaired influenza A virus replication by the host restriction factor SAMHD1 which inhibited by PA-mediated dephosphorylation of the host transcription factor IRF3Virology JournalJanuary 29, 2024Zhilei Zhao, Shuyi Han, Qingxun Zhang, Ye Wang, Kening Yue, Salbia Abbas, Hongxuan Heof RNA were reverse transcribed into cDNA using the GoScript™ Reverse Transcriptase System (Promega, A5004). RT‒qPCR was performed on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems, Carlsbad, CA)

(46) Dysregulated complement activation during acute myocardial infarction leads to endothelial glycocalyx degradation and endothelial dysfunction via the C5a:C5a-Receptor1 axisFrontiers in immunologyJanuary 1, 2024Vahldieck C, Löning S, Hamacher C, Fels B, Rudzewski B, Nickel L, Weil J, Nording H, Baron L, Kleingarn M, et al.was synthesized with the Go Script Reverse Transcriptase (Promega GmbH, Walldorf, Germany; catalog: A5003) and random hexamer primers (Thermo Fisher Scientific; catalog: SO142) according to the instructions

(47) Analogs of FTY720 inhibit TRPM7 but not S1PRs and exert multimodal anti-inflammatory effectsJournal of General PhysiologyJanuary 1, 2024Gregory W. Busey, Mohan C. Manjegowda, Tao Huang, Wesley H. Iobst, Shardul S. Naphade, Joel A. Kennedy, Catherine A. Doyle, Philip V. Seegren, Kevin R. Lynch, Bimal N. Desaiusing RNeasy Plus Micro Kit (74134; Qiagen). cDNA was produced using GoScript Reverse Transcriptase (A5004; Promega) and a quantitative PCR was performed using SensiFast SYBR (98020; Bioline) and Bio-Rad CFX

(48) Extending the toolbox for RNA biology with SegModTeX: a polymerase-driven method for site-specific and segmental labeling of RNANat CommunDecember 18, 2023Raphael Haslecker, Vincent V. Pham, David Glänzer, Christoph Kreutz, Theodore Kwaku Dayie, Victoria M. D'Souzashort (25-nt) primer (5’TCCATGACTCATGAACAAGAGACCC3’) using GoScript™ Reverse Transcriptase (Promega A5003). PCR amplification of the RT product was done with EconoTaq® PLUS (LGC Biosearch Technologies #300331)

(49) B Cells from Aged Mice Do Not Have Intrinsic Defects in Affinity Maturation in Response to ImmunizationJournal of immunology (Baltimore, Md. : 1950)November 15, 2023Lee JL, Innocentin S, Silva-Cayetano A, Guillaume SM, Linterman MA.U/μl RNase inhibitor (EO0381; Thermo Fisher Scientific), and 160 U GoScript Reverse Transcriptase (A5004; Promega) was then added to each well. The thermocycling program is then continued, with the following

(50) Comprehensive analysis of the lysine succinylome in fish oil-treated prostate cancer cellsLife science allianceNovember 1, 2023Jiang Y, He C, Ye H, Xu Q, Chen X, Chen Y, Sun J, Rocha S, Wang M.using TRI Reagent (Cat# T3809-100ML; Sigma-Aldrich), and RT was performed with GoScript RT System (Cat# A5003; Promega) from 1 μg of extracted RNA. Target genes were amplified by qRT–PCR with BRYT Green Dye (Cat#

(51) Btg2 Promotes Focal Segmental Glomerulosclerosis via Smad3‐Dependent Podocyte‐Mesenchymal TransitionAdvanced ScienceNovember 1, 2023Qiong‐ Dan Hu, Hong‐Lian Wang, Jian Liu, Tao He, Rui‐Zhi Tan, Qiong Zhang, Hong‐Wei Su, Fahsai Kantawong, Hui‐Yao Lan, Li Wangkidney and MPC5 cells. Reverse transcription was performed using the Reverse Transcription Kit (Promega, A5003, China). Then, PCR was performed with the Universal SYBR qPCR Master Mix (Vazyme, Q711‐02, China) on

(52) SET7/9-mediated methylation affects oncogenic functions of histone demethylase JMJD2AJCI insightOctober 23, 2023Gu R, Kim TD, Song H, Sui Y, Shin S, Oh S, Janknecht R.gene expression. For RT-PCR, RNA was reverse-transcribed with the GoScript Reverse Transcription System (catalog A5004; Promega) using p(dN)6 primers and then amplified by PCR according to standard procedures (78). Relative

(53) Cell-type-specific control of secondary cell wall formation by Musashi-type translational regulators in ArabidopsiseLifeSeptember 29, 2023Alicia Kairouani, Dominique Pontier, Claire Picart, Fabien Mounet, Yves Martinez, Lucie Le-Bot, Mathieu Fanuel, Philippe Hammann, Lucid Belmudes, Remy Merret, et al.were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20 μl final volume reaction using random primers (Cat. No. C1181; Promega) in the presence

(54) The Tyrosine Phosphatase Activity of PTPN22 Is Involved in T Cell Development via the Regulation of TCR ExpressionInternational journal of molecular sciencesSeptember 25, 2023Bai B, Li T, Zhao J, Zhao Y, Zhang X, Wang T, Zhang N, Wang X, Ba X, Xu J, et al.reverse transcribed to cDNA using the GoScript™ Reverse Transcriptase Kit (Promega, Madison, WI, USA, A5003), and the gene expression levels were analyzed using GoTaq® qPCR Master Mix (Promega, A6001) and reacted

(55) Jaw Bone Invasion of Oral Squamous Cell Carcinoma Is Associated with Osteoclast Count and Expression of Its Regulating Proteins in Patients and OrganoidsJournal of clinical medicineSeptember 18, 2023de Kort WWB, Haakma WE, van Es RJJ, Gawlitta D, Driehuis E, Gansevoort M, Willems SM.in water for 5 min at 70 °C. To generate cDNA, GoScript Reverse Transcriptase (Promega, catalog no. A5003) was used according to protocol. qPCR reactions were performed in 384-well format using IQ SYBR green

(56) Mobilisation of jerboa kidney gene networks during dehydration and opportunistic rehydrationiScienceSeptember 15, 2023Benjamin T. Gillard, Nabil Amor, Fernando Alvira Iraizoz, Audrys G. Pauža, Colin Campbell, Michael P. Greenwood, Abdulaziz N. Alagaili, David Murphymale and female animals. Total RNA (2μg) was converted to cDNA using GoScript Reverse Transcriptase (A5003, Promega) as per the manufacturer’s instructions. Primers were designed using Primer-BLAST64 targeting

(57) Diesel Exhaust Particle (DEP)-induced glucose intolerance is driven by an intestinal innate immune response and NLRP3 activation in miceParticle and Fibre ToxicologyJuly 3, 2023Angela J. T. Bosch, Theresa V. Rohm, Shefaa AlAsfoor, Andy J. Y. Low, Zora Baumann, Neena Parayil, Faiza Noreen, Julien Roux, Daniel T. Meier, Claudia Cavelti-WederUniversal Mini kit (Cat# 73,404, QIAGEN). Reverse transcription was performed with GoScript™ (Cat# A5003, Promega). GoTaq qPCR Master Mix (Cat# A4472919, Promega) was used for real-time PCR (ViiA7, Thermo

(58) Next Generation Exon 51 Skipping Antisense Oligonucleotides for Duchenne Muscular DystrophyNucleic Acid TherapeuticsJune 1, 2023Judith van Deutekom, Chantal Beekman, Suzanne Bijl, Sieto Bosgra, Rani van den Eijnde, Dennis Franken, Bas Groenendaal, Bouchra Harquouli, Anneke Janson, Paul Koevoets, et al.1,000 ng of total RNA with 3.2 μg random hexamer primers (No. 11034731001; Roche) and GoScript (No. A5003; Promega), according to the manufacturer's instructions. Protein lysates were prepared by adding 75

(59) GRP78/BiP alleviates oxLDL-induced hepatotoxicity in familial hypercholesterolemia caused by missense variants of LDLR in a HepG2 cellular modelLipids in health and diseaseMay 29, 2023Varghese DS, Oommen D, John A, Ali BR.of 250–500 ng total RNA was done using GoScript Reverse Transcriptase System (Promega, Catalog No. A5004). Relative mRNA expression of target genes was checked using SYBR® Green Real-Time qPCR Master Mix (Thermo Fisher Scientific

(60) CRISPR-Cas9 screen reveals a role of purine synthesis for estrogen receptor α activity and tamoxifen resistance of breast cancer cellsScience AdvancesMay 12, 2023Dina Hany, Vasiliki Vafeiadou, Didier PicardcDNA using random primers (Promega, no. C1181) and a GoScript reverse transcriptase kit (Promega, no. A5003). Quantitative real-time PCR (qPCR) reactions were done using specific primers and a GoTaq qPCR Master Mix

Be the First to Write a Review!