Reverse Transcription System from Promega

Product Specs
ItemReverse Transcription System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3500
Quantity100 reactions
PrimersOligo(dT)₁₅ Primer and Random Primers

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(641) Raft-like lipid microdomains drive autophagy initiation via AMBRA1-ERLIN1 molecular association within MAMsAutophagyJanuary 1, 0001"Manganelli V, Matarrese P, Antonioli M, Gambardella L, Vescovo T, Gretzmeier C, Longo A, Capozzi A, Recalchi S, Riitano G, et al."extracted using Trizol (Invitrogen, 15596-018) and retro-transcribed to cDNA using a RT-kit from Promega (A3500). qPCR were performed with the Rotor-Gene 6000 (Corbett Research Ltd) thermocycler, as previously described

(642) UBTD1 regulates ceramide balance and endolysosomal positioning to coordinate EGFR signalingeLifeJanuary 1, 0001"Torrino S, Tiroille V, Dolfi B, Dufies M, Hinault C, Bonesso L, Dagnino S, Uhler J, Irondelle M, Gay AS, et al."Spectrophotometer (Thermo Scientific). One microgram of total RNA was reverse transcribed into cDNA (A3500, Promega). Real-time quantitative PCR was performed using Fast SYBR Green master mix (Applied Biosystems)

(643) Cross-Comparison of Human iPSC Motor Neuron Models of Familial and Sporadic ALS Reveals Early and Convergent Transcriptomic Disease SignaturesCell systemsJanuary 1, 0001"Ho R, Workman MJ, Mathkar P, Wu K, Kim KJ, O'Rourke JG, Kellogg M, Montel V, Banuelos MG, Arogundade OA, et al."System,Worthington,LK003150 PureLink RNA Mini Kit,Thermo,12183018A Promega Reverse Transcription System,Promega,A3500 "ImmPRESS® HRP Horse Anti-Rabbit IgG Polymer Detection Kit, Peroxidase",Vector Laboratories,MP-7401 "ImmPACT® DAB

(644) Metallothionein 3 Controls the Phenotype and Metabolic Programming of Alternatively Activated MacrophagesCell reportsJanuary 1, 0001"Chowdhury D, Alrefai H, Landero Figueroa JA, Candor K, Porollo A, Fecher R, Divanovic S, Deepe GS Jr, Subramanian Vignesh K."Kit,QIAGEN,Cat#74104 QUICK-RNA MINIPREP KIT,Denville Scientific,Cat#R1055 Reverse Transcription System,Promega,Cat#A3500 Probe Lo-Rox 2X qPCR Mix,RADIANT,Cat#QP9020 NE-PER® Nuclear and Cytoplasmic Extraction Reagents,Thermo Scientific

(645) DMRT1-mediated regulation of TOX3 modulates expansion of the gonadal steroidogenic cell lineage in the chicken embryo"Development (Cambridge, England)"January 1, 0001"Estermann MA, Major AT, Smith CA."(Invitrogen) and 500 ng-1µg of RNA was converted into cDNA using Promega Reverse Transcription System (A3500). RT-qPCR was performed using QuantiNova SYBR Green PCR Kit. Primers used were: TOX3 Fw, TCAGAGCTTGGATCTCCCCT;

(646) Autophagy induction in atrophic muscle cells requires ULK1 activation by TRIM32 through unanchored K63-linked polyubiquitin chainsScience advancesJanuary 1, 0001"Di Rienzo M, Antonioli M, Fusco C, Liu Y, Mari M, Orhon I, Refolo G, Germani F, Corazzari M, Romagnoli A, et al."TRIzol reagent (Invitrogen, 15596-018). cDNA synthesis was generated using a reverse transcription kit (Promega, A3500), according to the manufacturer’s recommendations. qPCR reactions were performed with the Rotor-Gene

(647) Which One Would You Choose?-Investigation of Widely Used Housekeeping Genes and Proteins in the Spinal Cord of an Animal Model of Amyotrophic Lateral SclerosisNeuroSciJanuary 1, 0001"Epplen ASC, Stahlke S, Theiss C, Matschke V."synthesis of cDNA was carried out using a Reverse Transcription System (Promega, Madison, WI, USA, Cat# A3500), as outlined in the manufacturer’s protocol, with 1 μg of tRNA and oligo(dT) primer. The resulting

Be the First to Write a Review!