Reverse Transcription System from Promega

Product Specs
ItemReverse Transcription System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA3500
Quantity100 reactions
PrimersOligo(dT)₁₅ Primer and Random Primers

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(621) P15INK4B gene methylation and expression in normal, myelodysplastic, and acute myelogenous leukemia cells and in the marrow cells of cured lymphoma patientsLeukemiaOctober 6, 2001H D Preisler, B Li, H Chen, L Fisher, J Nayini, A Raza, S Creech, P Venugopalrehydrated with nuclease free water. cDNA was synthesized using a reverse transcription system kit (cat A3500; Promega, Madison, WI, USA). P15INK4B primers (p15INK4B 2F upstream primer 5⬘ ccagaagcaatccaggcgcg and

(622) Host nutritional selenium status as a driving force for influenza virus mutationsThe FASEB JournalAugust 1, 2001Heather K. Nelson, Qing Shi, Peter Van Dael, Eduardo J. Schiffrin, Stephanie Blum, Denis Barclay, Orville A. Levander, Melinda A. Beckfollowing the Promega (Madison, WI) Reverse Transcription System manufacturer’s instructions (Catalog # A3500). Primers were designed for amplification of the matrix (M), HA, and neuraminidase (NA) genes. PCR was

(623) Creatine transporter protein content, localization, and gene expression in rat skeletal muscleAmerican Journal of Physiology-Cell PhysiologyMarch 1, 2001R. Murphy, G. McConell, D. Cameron-Smith, K. Watt, L. Ackland, B. Walzel, T. Wallimann, R. SnowGaithersburg, MD). Oligo(dT) single-stranded DNA was synthesized by using AMV reverse transcriptase (kit A3500; Promega, Madison, WI) according to the manufacturer’s instructions. Primers complementary to selected regions

(624) Insulinotropic toxins as molecular probes for analysis of glucagon-likepeptide-1 receptor-mediated signal transduction in pancreatic beta-cellsBiochimieNovember 22, 2000G G Holz, C A Leech, J F Habeneraccomplished using AMV reverse transcriptase and oligo(dT) primers (Promega Reverse Transcriptase System, A3500). PCR amplification of cDNA was initiated using Taq DNA polymerase in combination with deoxyoligonucleotide

(625) Corticosteroid regulation of amiloride-sensitive sodium-channel subunit mRNA expression in mouse kidneyJournal of EndocrinologyApril 6, 2000P MacDonald, S MacKenzie, L E Ramage, J R Brown, R W Seckltranscription of mouse kidney RNA (oligo-dT primed using Promega Reverse Transcription system (No. A3500) according to the manufacturer’s instructions). RNA concentration was measured with accurate spectrophotometric

(626) Atrial but Not Ventricular Fibrosis in Mice Expressing a Mutant Transforming Growth Factor-β ₁ Transgene in the HeartCirculation ResearchMarch 17, 2000Hidehiro Nakajima, Hisako O. Nakajima, Olga Salcher, Andrea S. Dittiè, Klaus Dembowsky, Shaoliang Jing, Loren J. FieldcDNA synthesis reaction according to the manufacturer’s instructions (Promega reverse transcription system, model A3500). TaqMan PCR analysis was then performed using the Perkin Elmer PCR core reagent kit (N808-0228) and

(627) Poor prognosis acute myelogenous leukemia 2 — biological and molecular biological characteristics and treatment outcomeLeukemia ResearchMarch 4, 2000Biarou Li, Jie Yang, Ming Tao, Jaya Nayini, Erzsebet Horvath, Harpareet Chopra, PeterM Meyer, Paramesaran Venugopal, Harvey D Preisler

(628) Coordinated cytokine expression by stromal and hematopoietic cells during human osteoclast formationBoneFebruary 17, 2000G.J Atkins, D.R Haynes, S.M Geary, M Loric, T.N Crotti, D.M Findlay

(629) Platelet-derived growth factor ligand and receptor subunit mRNA in the Sertoli and Leydig cells of the rat testisMolecular and Cellular EndocrinologyDecember 16, 1994Kate Lakoski Loveland, Kristina Zlatic, Alicia Stein-Oakley, Gail Risbridger, David M. deKretser

(630) Electroacupuncture Suppresses CCI-Induced Neuropathic Pain through GABAA ReceptorsEvidence-based complementary and alternative medicine : eCAMJanuary 1, 0001"Li S, Jiang X, Wu Q, Jin Y, He R, Hu J, Zheng Y."(Invitrogen, Carlsbad, CA, USA). RNA (1 μg) was reverse transcribed using the RNA-to-cDNA Master Mix (A3500, Promega). Real-time amplification was performed on a LightCycler 480 (Roche, USA) using SYBR Green

(631) Overexpression of PFTK1 predicts resistance to chemotherapy in patients with oesophageal squamous cell carcinomaBritish journal of cancerJanuary 1, 0001"Miyagaki H, Yamasaki M, Miyata H, Takahashi T, Kurokawa Y, Nakajima K, Takiguchi S, Fujiwara Y, Ishii H, Tanaka F, et al."manufacturer. Total RNA was reverse transcribed to cDNA in a 20-μl volume using Reverse Transcription System (A3500 Promega, Madison, WI, USA). The reaction condition set based on the recommendation by the manufacturer.

(632) TBK1 mediates critical effects of measles virus nucleocapsid protein (MVNP) on pagetic osteoclast formationJournal of bone and mineral research : the official journal of the American Society for Bone and Mineral ResearchJanuary 1, 0001"Sun Q, Sammut B, Wang FM, Kurihara N, Windle JJ, Roodman GD, Galson DL."reagent according to the manufacturer’s instructions. Reverse transcription was conducted using a kit (#A3500) from Promega (Madison, WI). An aliquot of each cDNA product was used for qPCR analysis to measure the

(633) Focal ischemic stroke modifies microglia-derived exosomal miRNAs: potential role of mir-212-5p in neuronal protection and functional recoveryBiological researchJanuary 1, 0001"Li SS, Wu JJ, Xing XX, Li YL, Ma J, Duan YJ, Zhang JP, Shan CL, Hua XY, Zheng MX, et al."(Invitrogen, Carlsbad, CA, USA) and were reversely transcribed to cDNA using reverse transcription kit (A3500, Promega, Madison, WI, USA). Target genes were examined using a SYBR-Green RT–PCR kit (QPK-212, TOYOBO,

(634) Cognitive Alterations in Old Mice Are Associated with Intestinal Barrier Dysfunction and Induced Toll-like Receptor 2 and 4 Signaling in Different Brain RegionsCellsJanuary 1, 0001"Brandt A, Kromm F, Hernández-Arriaga A, Martínez Sánchez I, Bozkir HÖ, Staltner R, Baumann A, Camarinha-Silva A, Heijtz RD, Bergheim I."months old) showing too low RNA concentration were transcript to cDNA (reverse transcription system #A3500 obtained from Promega GmbH, USA) following the instructions of the manufacturer. The amplification of

(635) LMP1-deficient Epstein-Barr virus mutant requires T cells for lymphomagenesisThe Journal of clinical investigationJanuary 1, 0001"Ma SD, Xu X, Plowshay J, Ranheim EA, Burlingham WJ, Jensen JL, Asimakopoulos F, Tang W, Gulley ML, Cesarman E, et al."25300), then reversed transcribed using the Reverse Transcription System Kit (Promega, catalog no. A3500). cDNA was then amplified using primers that specifically detect the EBV Cp-derived EBNA1 transcript

(636) Histone Deacetylase Inhibitors Romidepsin and Vorinostat Promote Hepatitis B Virus Replication by Inducing Cell Cycle ArrestJournal of clinical and translational hepatologyJanuary 1, 0001"Yang Y, Yan Y, Chen Z, Hu J, Wang K, Tang N, Li X, Zhou Z."TRIzol (Invitrogen) and reverse transcribed using Moloney murine leukemia virus reverse transcriptase (A3500; Promega, Madison, WI, USA), in accordance with the manufacturer’s instructions. RT-qPCR was performed

(637) Cardiac Fibroblasts Adopt Osteogenic Fates and Can Be Targeted to Attenuate Pathological Heart CalcificationCell stem cellJanuary 1, 0001"Pillai ICL, Li S, Romay M, Lam L, Lu Y, Huang J, Dillard N, Zemanova M, Rubbi L, Wang Y, et al."using Qiagen RNA Isolation Kit and reverse transcription using Reverse Transcription System (Promega, A3500). qPCR was performed using the SensiMix SYBR and Fluorescein Kit (Quantace, QT615) on an iQ5 thermal

(638) AMBRA1 regulates mitophagy by interacting with ATAD3A and promoting PINK1 stabilityAutophagyJanuary 1, 0001"Di Rienzo M, Romagnoli A, Ciccosanti F, Refolo G, Consalvi V, Arena G, Valente EM, Piacentini M, Fimia GM."TRIzol reagent (Invitrogen, 15596–018). cDNA synthesis was generated using a reverse transcription kit (Promega, A3500), according to the manufacturer’s recommendations. qPCR reactions were performed with the Rotor-Gene

(639) Autophagy inhibition by sustained overproduction of IL6 contributes to arsenic carcinogenesisCancer researchJanuary 1, 0001"Qi Y, Zhang M, Li H, Frank JA, Dai L, Liu H, Zhang Z, Wang C, Chen G."and 18S rRNA. The first-strand cDNA was synthesized using a Reverse Transcription System (Promega, A3500). PCR was performed on a Lightcycler 480 system (Roche) using a Power SYBR Green PCR Master kit (Invitrogen,

(640) BRCA1-BARD1 regulates transcription through modulating topoisomerase IIβOpen biologyJanuary 1, 0001"Bunch H, Jeong J, Kang K, Jo DS, Cong ATQ, Kim D, Kim D, Cho DH, Lee YM, Chen BPC, et al."converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo). RT-qPCR was conducted with equal amounts of resultant

Be the First to Write a Review!