RNA 5 Pyrophosphohydrolase (RppH) M0356S from New England Biolabs

Product Specs
ItemRNA 5 Pyrophosphohydrolase (RppH)
CompanyNew England Biolabs
Price $103.00 Inquire
Catalog NumberM0356S
Size200 units
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Site-specific inhibition of translation initiation via 2'-O-methylationNucleic Acids ResSeptember 28, 2026Adam Suh, Stephanie Mou, Emmely A Patrasso, Hannah Serio, Rui Wang, Yue Zhao, Kevin Vasquez, Smriti Sangwan, Yang Yi, Daniel ArangoATP. Alternatively, in vitro transcribed RNAs were treated with RppH (New England Biolabs, Cat. #: M0356S), which converts 5′-triphosphates into 5′-monophosphates. 5′-monophosphorylated RNA products were purified

(2) Blocking the m6Am methyltransferase PCIF1 releases STAT1-mediated Th1 immunity to potentiate cancer immunotherapyNat CommunJuly 22, 2026Jiansong Huang, Jing Zhou, Xiao Liu, Xiaoxu Liu, Ye Xiao, Kai Li, Chenbo Ding, Xuemin Cai, Wenli Mao, Changfen Xu, et al.Liquid chromatography-tandem mass spectrometer (LC-MS/MS) For m6Am, 150 ng mRNA was decapped with 10 U RppH (NEB, M0356S) in ThermoPol buffer at 37 °C for 3 h. The decapped RNA was purified by ethanol precipitation and then

(3) Robust regulatory interplay of enhancers, facilitators, and promoters in a native chromatin contextCellJuly 17, 2026Zhou Zhou, Yang Cheng, Jaret Lieberth, Junke Zhang, Yiyang Jin, Albert Li, Haiyuan Yu, Abdullah Ozer, John T. LisT4 DNA Ligase,NEB,Cat#M0202M "T4 RNA Ligase I, High Concentration",NEB,Cat#M0437M RNA 5’ Pyrophosphohydrolase (RppH),NEB,Cat#M0356S T4 PNK,NEB,Cat#M0201L TriZol Reagent,Thermo Fisher,Cat#15596018 TriZol LS Reagent,Thermo Fisher,Cat#10296028 SUPERase·In

(4) The MLLT3 YEATS domain binds histone marks (H3K9/ 18/27ac/cr) and ncRNA (7SK), linking transcription and RNA signaling to regulate hematopoiesisCell ReportsJune 23, 2026Adam Boulton, Ashish Kabra, Nicholas Achille, Emmalee R. Adelman, Dimitrios G. Anastasakis, Felipe Beckedorff, Pradeep Kumar Reddy Reddy Cingaram, Devin G. Roller, Ying Zhang, Benjamin Leach, et al.(ARTKQTARKAcSTGGK),bioSYNTHESIS,N/A Biotin-11-ATP,PerkinElmer,Cat#NEL544001EA Biotin-11-CTP,PerkinElmer,Cat#NEL542001EA Biotin-11-GTP,PerkinElmer,Cat#NEL545001EA Biotin-11-UTP,PerkinElmer,Cat#NEL543001EA Streptavidin M280 beads,Invitrogen,Cat#11205D RppH,NEB,Cat#M0356S T4 polynucleotide kinase,NEB,Cat#M0201 SuperScript III,Thermo Fisher Scientific,Cat#18080044 AMpure

(5) Dose-dependent hormone actions at estrogen receptor enhancers specify distinct molecular and biological outcomesSci AdvJune 5, 2026Hyung Bum Kim, Tulip Nandu, Yoon Jung Kim, Cristel V. Camacho, W. Lee Krauspresence of ATP (adenosine 5′-triphosphate), followed by 5′ decapping by RNA 5′ pyrophosphohydrolase (NEB, M0356S), and 5′ adaptor ligation to the VRA5 adaptor using RNA ligase. Ligated RNA was then eluted from the

(6) Transcription initiation profiling defines the regulatory logic of astrocyte gene regulationbioRxivMay 28, 2026Ashley Kumar, Yanning Zuo, Numaan Formoli, Daimeng Sun, Narayan Pokhrel, Carlos Guzman, Sven Heinz, Christopher Benner, Francesca TeleseRNA 5´ Pyrophosphohydrolase (RppH) to convert the 5´ end of triphosphorylated RNA to a 5´ monophosphate RNA (NEB Cat#M0356S). Adapters were ligated to both the 5’ cap end and the 3’ end. The RNA was synthesized into cDNA with

(7) 53BP1 orchestrates sequence feature of RAG targets to balance DNA repair outcomes during V(D)J recombinationSci AdvMay 22, 2026Sha Luo, Hailiang Zha, Zifan Yang, Shuchan Li, Leyi Yu, Ruolin Qiao, Ruoxi Kong, Yifan Wang, Junhong Guan, Xuefei Zhangthe enriched run-on samples were incubated with end repair with T4 PNK (NEB, M0201S) and RppH (NEB, M0356S), followed by ligation the 5′ and 3′ RNA adaptors. Reverse transcription PCR was performed from the

(8) Generation of precise and accurate engineered circRNAs using enzymatic ligationNucleic Acids ResMay 8, 2026Amrita Singh, Adela Dujsikova, Noah Mueller, Y Grace ChenIn the second approach, pyrophosphates were removed by using 10 units of pyrophosphatase RppH (NEB #M0356S) on 2 µg of in vitro transcribed RNAs at 37°C for 30 min. The third approach used 5× or 10× excess guanosine

(9) tRNA-derived RNA processing in sperm transmits non-genetically inherited phenotypes to offspring in C. elegansNature CommunicationsMarch 15, 2026Nicholas S. Galambos, Olivia J. Crocker, Blair K. Schneider, Kennelly S. Allerton, Katrin E. Gross, Alexandra E. Schneider, Jared Lynch, Onur Yukselen, Alper Kucukural, Colin C. Conineafter complete ethanol removal, the pellet was reconstituted in RNA 5′ Pyrophosphohydrolase (RppH - NEB M0356S) per manufacturers guidelines and incubated at 37 °C for 1 h. Following RppH treatment, small RNAs were

(10) Chromatin-intrinsic mechanisms determine orientation-specific class switch recombinationNature CommunicationsFebruary 28, 2026Sha Luo, Ruolin Qiao, Hailiang Zha, Leyi Yu, Xiaoling Shan, Shuchan Li, Zifan Yang, Aoyu Ma, Yaxin Cheng, Yao-Feng Zhao, et al.enriched run-on samples were incubated with hydroxyl repair with T4 PNK (NEB, M0201S) and RppH (NEB, M0356S), followed by ligating the 5′ and 3′ RNA adaptor. RT-PCR was performed from the adaptor-ligated RNA

(11) Fragile nucleosomes are essential for RNA Polymerase II to transcribe in eukaryotesbioRxivFebruary 27, 2026Lingbo Li, Samuel Hunter, Sonia Leach, Yonghua Zhuang, Haolin Liu, Junfeng Gao, Qianqian Zhang, Timothy J. Stasevich, Hiroshi Kimura, Robin Dowell, et al.repair, the RNA-bound beads were treated with T4 PNK (NEB #M0201S) and subsequently with RppH (NEB #M0356S). 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’ UGGAAUUCUCGGGUGCCAAGG, final conc. 0.5 uM)

(12) NAD+ capping of sibD transcripts in E. coli is mediated by its minimal promoter and enhanced by ppGppNucleic Acids ResearchFebruary 24, 2026Wuzhen Liu, Kefan Hu, Shiqi Nie, Zhang Feng, Qiongfang Li, Hailei Zhang, Shumin Liang, Jialin Peng, Shoudong Zhang, Zongwei Cai, et al.subjected to a decapping assay by incubating 20 ng of RNA with 0.5 μl NudC (M0607S, NEB) and 0.5 μl RppH (M0356S, NEB). For SibD RNAs, the decapped SibD RNAs were circularized with 30 U T4 RNA ligase (Thermo Fisher)

(13) piRNAs safeguard splicing and RNA fidelity during heat shockbioRxivFebruary 12, 2026Sehee Min, Johnny Cruz-Corchado, Veena Prahladinto mRNA (>200 nt) and small RNA (<200 nt). Small RNA samples were treated with 10U RppH (NEB; Cat #M0356S) at 37°C for 30 min, then purified using the Zymo RNA Clean & Concentrator kit (Zymo Research; Cat #R1015).

(14) Cell-type-specific RNA polymerase II activity maps in intact tissues provide a gateway to mammalian gene regulatory mechanisms in vivoDevelopmental CellFebruary 11, 2026Gopal Chovatiya, Sean Y. Huang, Alex B. Wang, Philip Versluis, Chris K. Bai, Michael DeBerardine, Yu-Ching Liao, Judhajeet Ray, Abdullah Ozer, John T. Lis, et al.resuspending beads with nascent RNA in RppH reaction mix (10x ThermoPol buffer (NEB, B9004S), RppH (NEB, M0356S), SUPERase-In RNase Inhibitor) and incubating at 37°C for 45 minutes on thermomixer at 500 rpm. Following

(15) Sensitizing tumor response to topoisomerase I antibody drug conjugate by selective CDK7 inhibitionbioRxivJanuary 16, 2026Hyerim Jung, Yoonji Lee, Donghoon Yu, Yeejin Jeon, Hwankyu Kang, Dahun Um, Mooyoung Seo, Dongsik Park, Jeongjun Kim, Seung-Joo Lee, et al.qPRO-seq protocol (47). Following the ligation of the 3' adapter, samples were treated with RppH (NEB, M0356S) and PNK (NEB, M0201S), and 5' adapter was ligated. RNA was purified using streptavidin-coupled magnetic

(16) Profiling active RNA polymerase II transcription start sites from total RNA by capped small RNA sequencing (csRNA-seq)Nature ProtocolsJanuary 16, 2026Mackenzie K. Meyer, Oluwadamilola J. Olanrewaju, Patricia Montilla-Perez, Anna L. McDonald, Eva M. Rickard, Francesca Telese, Christopher Benner, Marina I. Savenkova, Sascha H. Duttke(New England Biolabs, cat. no. M0525L)RNA 5’ Pyrophosphohydrolase (RppH, New England Biolabs, cat. no. M0356S)2-Propanol (Sigma-Aldrich, cat. no. I9516–25ML) ! CAUTION: Highly flammable liquid and vapor. Causes

(17) A SET domain-containing protein and HCF-1 maintain transgenerational epigenetic memoryNature CommunicationsJanuary 9, 2026Chenming Zeng, Giulia Furlan, Miguel Vasconcelos Almeida, Juan C. Rueda-Silva, Jonathan Price, Helena Santos-Rosa, Jingxiu Xu, Yan Kuang, Enric Cata Socias, Jonas Mars, et al.two-sided unpaired t-test. small RNA-seq and sequencing analysis Total RNAs were treated with RppH (NEB #M0356S)130, and small RNA libraries were prepared with a small RNA-seq Kit v4 with UDIs (Nextflex #NOVA-5132-31).

(18) Hypoxia leads to reduced mito-nuclear gene expression and increased mtDNA transcriptional pausing in human cellsCommunications BiologyJanuary 8, 2026Noam Shtolz, Sarah Dadon, Dan Mishmarrepaired with RNA 5′ pyrophosphohydrolase, followed by phosphorylation with T4 polynucleotide kinase (M0356S and M0201S, both from NEB). Next, the 5′ ends of the RNA molecules were ligated to the Rev5 RNA adapter

(19) Phage-encoded small RNA hijacks host replication machinery to support the phage lytic cycleMolecular CellDecember 18, 2025Aviezer Silverman, Raneem Nashef, Reut Wasserman, Tamar Noy, Susan Born, Tianyou Yao, Yuncong Geng, Hila Rotbard, Adi Levkowitz, Yotam Kaufman, et al.inhibitor,Takara,Cat#2313A RNase T1,Boehringer,N/A DMS,Fluka,Cat#41610 RppH,New England Biolabs,Cat#M0356S 5′-Phosphate-Dependent Exonuclease (TeX),Lucigen,Cat#TER51020 5-bromo-2′-deoxyuridine (BrdU),Sigma Aldrich

(20) A new role for PHYHD1 and related dioxygenases: demethylation of 2'-O-methylated nucleosidesNucleic Acids ResDecember 11, 2025Justas Stonkus, Rasa Rutkienė, Rita Meškienė, Martyna Jasiūnienė, Agota Aučynaitė, Laura Kalinienė, Justas Lazutka, Darius Balčiūnas, Giedrius Vilkaitis, Rolandas Meškyshydrolysis Purified mRNA was first incubated with RNA 5′ pyrophosphohydrolase (RppH, New England Biolabs, USA, #M0356S) in NEB buffer 2 according to the manufacturer’s instructions. Total RNA and decapped mRNA were first

Be the First to Write a Review!

RNA 5 Pyrophosphohydrolase (RppH)

RNA 5 Pyrophosphohydrolase (RppH) from New England Biolabs

New England Biolabs

Citations (121)

Reviews

RNA 5 Pyrophosphohydrolase (RppH) from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map