RNA 5 Pyrophosphohydrolase (RppH) M0356S from New England Biolabs

Product Specs
ItemRNA 5 Pyrophosphohydrolase (RppH)
CompanyNew England Biolabs
Price $103.00 Inquire
Catalog NumberM0356S
Size200 units
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) 53BP1 orchestrates sequence feature of RAG targets to balance DNA repair outcomes during V(D)J recombinationSci AdvMay 22, 2026Sha Luo, Hailiang Zha, Zifan Yang, Shuchan Li, Leyi Yu, Ruolin Qiao, Ruoxi Kong, Yifan Wang, Junhong Guan, Xuefei Zhangthe enriched run-on samples were incubated with end repair with T4 PNK (NEB, M0201S) and RppH (NEB, M0356S), followed by ligation the 5′ and 3′ RNA adaptors. Reverse transcription PCR was performed from the

(2) Generation of precise and accurate engineered circRNAs using enzymatic ligationNucleic Acids ResMay 8, 2026Amrita Singh, Adela Dujsikova, Noah Mueller, Y Grace ChenIn the second approach, pyrophosphates were removed by using 10 units of pyrophosphatase RppH (NEB #M0356S) on 2 µg of in vitro transcribed RNAs at 37°C for 30 min. The third approach used 5× or 10× excess guanosine

(3) tRNA-derived RNA processing in sperm transmits non-genetically inherited phenotypes to offspring in C. elegansNature CommunicationsMarch 15, 2026Nicholas S. Galambos, Olivia J. Crocker, Blair K. Schneider, Kennelly S. Allerton, Katrin E. Gross, Alexandra E. Schneider, Jared Lynch, Onur Yukselen, Alper Kucukural, Colin C. Conineafter complete ethanol removal, the pellet was reconstituted in RNA 5′ Pyrophosphohydrolase (RppH - NEB M0356S) per manufacturers guidelines and incubated at 37 °C for 1 h. Following RppH treatment, small RNAs were

(4) Chromatin-intrinsic mechanisms determine orientation-specific class switch recombinationNature CommunicationsFebruary 28, 2026Sha Luo, Ruolin Qiao, Hailiang Zha, Leyi Yu, Xiaoling Shan, Shuchan Li, Zifan Yang, Aoyu Ma, Yaxin Cheng, Yao-Feng Zhao, et al.enriched run-on samples were incubated with hydroxyl repair with T4 PNK (NEB, M0201S) and RppH (NEB, M0356S), followed by ligating the 5′ and 3′ RNA adaptor. RT-PCR was performed from the adaptor-ligated RNA

(5) Fragile nucleosomes are essential for RNA Polymerase II to transcribe in eukaryotesbioRxivFebruary 27, 2026Lingbo Li, Samuel Hunter, Sonia Leach, Yonghua Zhuang, Haolin Liu, Junfeng Gao, Qianqian Zhang, Timothy J. Stasevich, Hiroshi Kimura, Robin Dowell, et al.repair, the RNA-bound beads were treated with T4 PNK (NEB #M0201S) and subsequently with RppH (NEB #M0356S). 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’ UGGAAUUCUCGGGUGCCAAGG, final conc. 0.5 uM)

(6) NAD+ capping of sibD transcripts in E. coli is mediated by its minimal promoter and enhanced by ppGppNucleic Acids ResearchFebruary 24, 2026Wuzhen Liu, Kefan Hu, Shiqi Nie, Zhang Feng, Qiongfang Li, Hailei Zhang, Shumin Liang, Jialin Peng, Shoudong Zhang, Zongwei Cai, et al.subjected to a decapping assay by incubating 20 ng of RNA with 0.5 μl NudC (M0607S, NEB) and 0.5 μl RppH (M0356S, NEB). For SibD RNAs, the decapped SibD RNAs were circularized with 30 U T4 RNA ligase (Thermo Fisher)

(7) piRNAs safeguard splicing and RNA fidelity during heat shockbioRxivFebruary 12, 2026Sehee Min, Johnny Cruz-Corchado, Veena Prahladinto mRNA (>200 nt) and small RNA (<200 nt). Small RNA samples were treated with 10U RppH (NEB; Cat #M0356S) at 37°C for 30 min, then purified using the Zymo RNA Clean & Concentrator kit (Zymo Research; Cat #R1015).

(8) Cell-type-specific RNA polymerase II activity maps in intact tissues provide a gateway to mammalian gene regulatory mechanisms in vivoDevelopmental CellFebruary 11, 2026Gopal Chovatiya, Sean Y. Huang, Alex B. Wang, Philip Versluis, Chris K. Bai, Michael DeBerardine, Yu-Ching Liao, Judhajeet Ray, Abdullah Ozer, John T. Lis, et al.resuspending beads with nascent RNA in RppH reaction mix (10x ThermoPol buffer (NEB, B9004S), RppH (NEB, M0356S), SUPERase-In RNase Inhibitor) and incubating at 37°C for 45 minutes on thermomixer at 500 rpm. Following

(9) Profiling active RNA polymerase II transcription start sites from total RNA by capped small RNA sequencing (csRNA-seq)Nature ProtocolsJanuary 16, 2026Mackenzie K. Meyer, Oluwadamilola J. Olanrewaju, Patricia Montilla-Perez, Anna L. McDonald, Eva M. Rickard, Francesca Telese, Christopher Benner, Marina I. Savenkova, Sascha H. Duttke(New England Biolabs, cat. no. M0525L)RNA 5’ Pyrophosphohydrolase (RppH, New England Biolabs, cat. no. M0356S)2-Propanol (Sigma-Aldrich, cat. no. I9516–25ML) ! CAUTION: Highly flammable liquid and vapor. Causes

(10) Sensitizing tumor response to topoisomerase I antibody drug conjugate by selective CDK7 inhibitionbioRxivJanuary 16, 2026Hyerim Jung, Yoonji Lee, Donghoon Yu, Yeejin Jeon, Hwankyu Kang, Dahun Um, Mooyoung Seo, Dongsik Park, Jeongjun Kim, Seung-Joo Lee, et al.qPRO-seq protocol (47). Following the ligation of the 3' adapter, samples were treated with RppH (NEB, M0356S) and PNK (NEB, M0201S), and 5' adapter was ligated. RNA was purified using streptavidin-coupled magnetic

(11) A SET domain-containing protein and HCF-1 maintain transgenerational epigenetic memoryNature CommunicationsJanuary 9, 2026Chenming Zeng, Giulia Furlan, Miguel Vasconcelos Almeida, Juan C. Rueda-Silva, Jonathan Price, Helena Santos-Rosa, Jingxiu Xu, Yan Kuang, Enric Cata Socias, Jonas Mars, et al.two-sided unpaired t-test. small RNA-seq and sequencing analysis Total RNAs were treated with RppH (NEB #M0356S)130, and small RNA libraries were prepared with a small RNA-seq Kit v4 with UDIs (Nextflex #NOVA-5132-31).

(12) Hypoxia leads to reduced mito-nuclear gene expression and increased mtDNA transcriptional pausing in human cellsCommunications BiologyJanuary 8, 2026Noam Shtolz, Sarah Dadon, Dan Mishmarrepaired with RNA 5′ pyrophosphohydrolase, followed by phosphorylation with T4 polynucleotide kinase (M0356S and M0201S, both from NEB). Next, the 5′ ends of the RNA molecules were ligated to the Rev5 RNA adapter

(13) Phage-encoded small RNA hijacks host replication machinery to support the phage lytic cycleMolecular CellDecember 18, 2025Aviezer Silverman, Raneem Nashef, Reut Wasserman, Tamar Noy, Susan Born, Tianyou Yao, Yuncong Geng, Hila Rotbard, Adi Levkowitz, Yotam Kaufman, et al.inhibitor,Takara,Cat#2313A RNase T1,Boehringer,N/A DMS,Fluka,Cat#41610 RppH,New England Biolabs,Cat#M0356S 5′-Phosphate-Dependent Exonuclease (TeX),Lucigen,Cat#TER51020 5-bromo-2′-deoxyuridine (BrdU),Sigma Aldrich

(14) The Incoming Influenza Genome Assembles a Host RBP Network that Orchestrates Viral RNA SynthesisbioRxivDecember 11, 2025Stephen Clarke, Deep B. Patel, Andrea Ascura, Caroline L. Wiser, Jennifer L. Pennise, Samantha M. Lisy, Manuel AscanoUniversity),N/A T4 DNA ligase,New England Biolabs,M0202T RNA 5’Pyrophosphohydrolase (RppH),New England Biolabs,M0356S "RNase inhibitor, Murine",New England Biolabs,M0314S DNase I (RNase free),New England Biolabs,M0303S TPCK-trypsin,Thermo Fischer Scientific

(15) CTCF couples long-range loop extrusion and diffusion to mediate a diverse Igκ repertoireNature CommunicationsDecember 11, 2025Emma L. Bush, Brigette Berke-Reynolds, Kaitlyn M. Hutchins, Xinrui Yu, Jorge A. Colón-Rosado, Fujung Chang, John Curran, Jiaxin Yang, Liangliang Sun, Jianrong Wang, et al.Dynabeads MyOne Streptavidin C1 beads, treated with RNA 5’ Pyrophosphohydrolase (New England Biolabs, M0356S) and T4 Polynucleotide Kinase (New England Biolabs, M0201S), and sequentially ligated to 5’ and 3’ RNA

(16) RG motifs promote piRNA-mediated gene silencing in C. elegansNucleic Acids ResDecember 11, 2025Dylan C Wallis, Carolyn M Phillipspolyphosphatase (Epicentre, RP8092H) (total small RNA samples) or 5′ RNA pyrophosphohydrolase (NEB M0356S) (IP samples) and ligated to 3′ pre-adenylated adapters with truncated T4 RNA ligase (NEB M0373L). Small

(17) A new role for PHYHD1 and related dioxygenases: demethylation of 2'-O-methylated nucleosidesNucleic Acids ResDecember 11, 2025Justas Stonkus, Rasa Rutkienė, Rita Meškienė, Martyna Jasiūnienė, Agota Aučynaitė, Laura Kalinienė, Justas Lazutka, Darius Balčiūnas, Giedrius Vilkaitis, Rolandas Meškyshydrolysis Purified mRNA was first incubated with RNA 5′ pyrophosphohydrolase (RppH, New England Biolabs, USA, #M0356S) in NEB buffer 2 according to the manufacturer’s instructions. Total RNA and decapped mRNA were first

(18) Argonaute-siRNA loading via the RNA-binding protein RDE-4 in C. elegansCurrent BiologyDecember 1, 2025Thiago L. Knittel, Brooke E. Montgomery, Reese A. Sprister, Colin N. Magelky, Margaret J. Smith, Maritza Soto-Ojeda, Melissa Guthrie, Carolyn M. Phillips, Taiowa A. Montgomeryby Thermo Fisher Scientific",Cat# NW04127BOX RNA 5′ Pyrophosphohydrolase,New England Biolabs,Cat# M0356S Alt-R™ S.p. Cas9 Nuclease V3,Integrated DNA Technologies,Cat# 1081058 Critical commercial assays,Critical

(19) TAF1 is required for fetal but not adult hematopoiesis in miceDevelopmental CellNovember 3, 2025Fan Liu, Jingyin Yue, Francesco Tamiro, Jun Sun, Pradeep Kumar Reddy Cingaram, Krystal Lisa Hossack, Concepcion Martinez Caja, Ye Xu, Chuan Chen, Felipe Beckedorff, et al.purified by streptavidin beads M-280 (Invitrogen, 11205D), and the 5' cap was removed using RppH (NEB, M0356S). T4 polynucleotide kinase (NEB, M0201) was then used to repair the 5' hydroxyl terminus. Following

(20) Argonautes and small RNAs associated with nematode programmed DNA eliminationbioRxivOctober 27, 2025Maxim V. Zagoskin, Yuanyuan Kang, Richard E. Davis, Jianbin Wang°C). To enable cloning of siRNAs carrying 5′ triphosphates, samples were treated with RppH (NEB, catalog #M0356S) in ThermoPol buffer for 1 h at 37 °C to remove cap and convert 5′ di- and triphosphates to monophosphates

Be the First to Write a Review!

RNA 5 Pyrophosphohydrolase (RppH)

RNA 5 Pyrophosphohydrolase (RppH) from New England Biolabs

New England Biolabs

Citations (114)

Reviews

RNA 5 Pyrophosphohydrolase (RppH) from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map