HiScribe T7 High Yield RNA Synthesis Kit E2040S from New England Biolabs

Product Specs
ItemHiScribe T7 High Yield RNA Synthesis Kit
CompanyNew England Biolabs
Price $244.00 Inquire
Catalog NumberE2040S
Quantity50 reactions
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(21) Structural basis of RNA-guided transcription by a dCas12f–σE–RNAP complexNatureMay 7, 2026Renjian Xiao, Florian T. Hoffmann, Dan Xie, Tanner Wiegand, Adriana I. Palmieri, Samuel H. Sternberg, Leifu Chang150-nt, 100-nt, and 50-nt RNA products, using the HiScribe® T7 High Yield RNA Synthesis Kit (NEB # E2040S) and radiolabeled NTPs as described above. The in vitro transcription of control ecoRNAP-σ70 was performed

(22) Novel mouse line with D277N mutation in the Plau gene displays autism spectrum disorder-like traitsFront Cell Dev BiolMay 6, 2026Maxim Karagyaur, Olga Averina, Kirill Bozov, Stalik Dzhauari, Anastasia Priymak, Raushana Khaybullina, Oleg Permyakov, Vladimir Popov, Olga Grigorieva, Maria Illarionova, et al.5′-TGGAGCAGCTCATCTTGCACGAATACTACAGGGAAGACAGCCTGGCCTACCATAATAATATTGGTGAGCAGAAAGCTTAGTTACCAGAAAGGCTAAAGTAGTGGTGGGAAA-3’. To synthesize guide RNAs we used HiScribe T7 High Yield RNA Synthesis Kit (NEB, #E2040S) and the DNA matrix obtained using Phanta Max Super-Fidelity DNA Polymerase kit (Vazyme, #P505-d3),

(23) Molecular insights into DDX3X–androgen receptor mRNA regulation via non-canonical G-quadruplex in castration-resistant prostate cancerOncogeneMay 4, 2026Han Zhang, Teresa T. Liu, Feixuan Wu, Avan N. Colah, Emily A. Ricke, Lingjun Li, Andrea A. Putnam, William A. Ricke(TAATACGACTCACTATAGGGAATTTTTCCTTCGGAATTTATCAATAGTGC; ordered from IDT) using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S) and subsequently biotinylated with the Pierce RNA 3’ End Biotinylation Kit (Thermo Scientific, 20160).

(24) A kinetic approach for mapping seed regions of CRISPR ribonucleoprotein and improving specificityNucleic Acids ResearchMay 4, 2026Wei Feng, Jianyu Hu, Hongquan Zhang, X Chris Leused as the template for 20 µl T7 transcription using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, #E2040S). RNA was treated with DNase I (NEB, #M0303S), purified with TRIzol Reagent (Thermo Fisher Scientific,

(25) Plant-associated fungi co-opt ancient antimicrobials for host manipulationSci AdvApril 29, 2026Fantin Mesny, Valentina Wolf, Ana López-Moral, Anton Kraege, Wilko Punt, Saifei Liu, Jinyi Zhu, Jiyeun Park, Yukiyo Sato, Bart P. H. J. Thomma(25 mM each), 1.5 μl of T7 buffer (10×), 1.5 μl of HiScribe T7 polymerase (New England Biolabs; ref. E2040S), 1 μl of dithiothreitol (0.1 M), and nuclease-free water up to 20 μl total volume. After incubation

(26) Ribosome biogenesis bottlenecks reveal vulnerabilities in cancerbioRxivApril 24, 2026Lifei Jiang, Qiwei Yu, Sofia A. Quinodoz, Jordy F. Botello, Sabreen Alam, Jing Xia, Jonida Trako, Troy J. Comi, Aya A. Abu-Alfa, Yong Wei, et al.gel purified prior to transcription. IVT was performed using the HiScribe T7 RNA Synthesis Kit (NEB, E2040S) at 37 °C for 8–12 h following the manufacturer’s protocol with minor modifications. To generate 5eU-labeled

(27) Systematic screening of archaeal MazF homologs reveals Tth-MazF1, a versatile, sequence-specific ribonuclease from Thermococcus thioreducensNucleic Acids ResApril 24, 2026Benjamin F Jepson, Eric J Wolf, Anthony R Dawson, Jingmin Jin, Vladimir Potapov, Nan Dai, Ivan R Corrêa Jr., Erbay Yigitfollowing manufacturer’s recommendation at 37°C overnight, and template DNA was removed by DNase I (NEB, E2040S). The quality and purity of the resulting 1.57 kb RNA was assessed by gel electrophoresis, purified,

(28) Circular mRNA against CleanCap linear mRNA vectors: comprehensive comparison, expression, active and passive immunizationFrontiers in ImmunologyApril 24, 2026Vladimir M. Vakhtinskii, Irina L. Tutykhina, Alina S. Dzharullaeva, Daria M. Grousova, Ilya D. Zorkov, Anna A. Ilyukhina, Dmitrii A. Reshetnikov, Valentin V. Azizyan, Artem A. Derkaev, Evgeniia N. Bykonia, et al.produced via in vitro transcription (IVT) using the HiScribe T7 High Yield mRNA Synthesis Kit (NEB #E2040S) according to the manufacturer`s recommendations. The reaction mix for circular mRNA contained canonical

(29) Multimodal profiling reveals cell type-specific pseudouridine modification and density-dependent translational regulationNucleic Acids ResApril 21, 2026Caroline A McCormick, Michele Meseonznik, Yuchen Qiu, Oleksandra Fanari, Priyanka Goyal, Mitchell Thomas, Mina Shokoufandeh, Yifang Liu, Dylan Bloch, Cole Greenfield, et al.concentrations of 0, 0.5, 1, 1.5, and 2% using the Hi-Scribe T7 High Yield RNA Synthesis Kit (NEB, E2040S). IVT products were cleaned up using the Monarch Spin RNA Cleanup Kit (NEB, T2040L). mRNA concentration

(30) Hijacking innate immunity to enhance mRNA therapeutics by blocking IFN-P-body-XRN1 axis-mediated degradationNature CommunicationsApril 17, 2026Tinghong Zhang, Xing Peng, Jinling Qin, Binqiang Zhu, Shuaihua Zhang, Shijie Deng, Zhimin Song, Yulong Han, Hui Zheng, Jingjing Chen, et al.from Promega. NEBNext Ultra RNA Library Prep Kit (E7530L), HiScribe T7 High Yield RNA Synthesis Kit (E2040S), Anti-Reverse Cap Analog (ARCA, S1411L), and Magnetic mRNA Isolation Kit (S1550S) were obtained from

(31) Lineage-specific evolution, structural diversity, and activity of R2 retrotransposons in animalsGenome BiologyApril 14, 2026Nozhat T. Hassan, Briana Van Treeck, Anthony Rodríguez-Vargas, Anna E. Sheppard, Kathleen Collins, David L. Adelson(NEB) or pseudouridine (TriLink, catalogue no. N-1019–10) with the HiScribe T7 Kit (NEB, catalogue no. E2040S) according to the manufacturer’s instructions for RNAs < 300 nt. Purification was the same as for the

(32) Direct RNA nanopore sequencing reveals rapid RNA modification changes following glucose stimulation of human pancreatic beta-cell linesbioRxivApril 12, 2026Logan Mulroney, Henry J. Taylor, Angela Lee, Amy J. Swift, Mihail Zdravkov, Lori L. Bonnycastle, Shelise Y. Brooks, Brian N. Lee, Tomas Fitzgerald, Narisu Narisu, et al.of our cDNA template to synthesize IVT RNA using the HiScribe® T7 High Yield RNA Synthesis Kit (NEB E2040S) according to manufacturer’s protocol, except that the samples were incubated for 2 hours at 42°C instead

(33) Genotype-by-inhibitor interactions to dissect enterovirus replicationNature CommunicationsApril 11, 2026William Bakhache, Walker Symonds-Orr, Patrick T. Dolanand used as templates for in vitro transcription with the HiScribe T7 High Yield RNA Synthesis Kit (E2040S; New England Biolabs) at 37 °C for 2 h. Following transcription, RNA was treated with DNase I (M0303L;

(34) RNA promotes synapsin phase separation providing a platform for local translationbioRxivApril 11, 2026Branislava Rankovic, Zachary M Geisterfer, Akshita Chhabra, Vladimir M Jovanovic, Ian Seim, Christian Hoffmann, Antonela Condric, Gerard Aguilar Aguilar Pérez, Rinse de Boer, Lars T. Hofstede, et al.and Prnp, the in vitro transcription was carried out according to manufacturer’s instructions (NEB, E2040S), with the following modifications. Reactions included 1 μg of DNA template and were supplemented with

(35) Nascent transcript O-MAP reveals the molecular architecture of a single-locus subnuclear compartment built by RBM20 and the TTN RNAbioRxivApril 8, 2026Evan E. Kania, Aidan Fenix, Daphnée M. Marciniak, Qiaoyi Lin, Sara Bianchi, Borislav Hristov, Shuai Li, Conor K. Camplisson, Rose Fields, Brian J. Beliveau, et al.used as templates for in vitro RNA synthesis using the HiScribe T7 High Yield RNA Synthesis Kit (NEB; E2040S), in a final reaction volume of 30 μL, following the manufacturer’s provided protocol. Reactions were

(36) U2AF regulates the translation and localization of nuclear-encoded mitochondrial mRNAsMol CellApril 2, 2026Gloria R. Garcia, Murali Palangat, Josquin Moraly, Benjamin T. Donovan, Bixuan Wang, Ira Phadke, David Sturgill, Jiji Chen, Guofeng Zhang, Ronald J. Holewinski, et al.Mitochondria Isolation Kit for Cultured Cells,Thermo Fisher,89874 EasyPep kit,Thermo Fisher,A40006 HiScribe T7 RNA synthesis kit,NEB,E2040S Monarch RNA cleanup kit,NEB,T2040L DNA Clean & Concentrator Kit,Zymo,D4003 HiScribe SP6 RNA synthesis kit

(37) Lipid nanoparticle delivery of circle RNA vaccine induces potent immune responsesSci RepApril 2, 2026Ruohan Yang, Lin Jia, Jiuwei Cui(Sigma-Aldrich, F1804). circRNA was synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (NEB E2040S). IVT templates were amplified via PCR before RNA synthesis (Q5 Hot Start High Fidelity 2x Master Mix).

(38) Robust CD8+ T cell responses induced by an mRNA-LNP vaccine encoding rat HER2 extracellular domain confer prophylactic tumor protectionFront ImmunolApril 1, 2026Kexin Li, Xiaoya Li, Cong Zhang, Suli Dai, Lei Li, Jun Wang, Hongtao Zhang, Lianmei ZhaoThermo Scientific, USA) and served as templates for in vitro transcription employing T7 RNA polymerase (#E2040S, New England Biolabs, USA). During transcription, m1ψ-5’-triphosphate (#N-1081-10, TriLink, USA) was

(39) Single-cell phenotypic heterogeneity shapes quorum signaling dynamics in Pseudomonas aeruginosaNature CommunicationsMarch 31, 2026Danielle G. Lange, Vadim Litvinov, Daniel DarAgilent DNA TapeStation. 3 µg of purified DNA were transcribed in vitro with the HiScribe T7 kit (NEB, E2040S) according to the manufacturer’s short-transcript protocol (8–12 h, 37 °C). 5 µL of RNA was column-purified

(40) lncRNA ch-MYC-AS1 restricts ALV-J replication by disrupting the ANXA2-C-Myc oncogenic axisMicrobiology SpectrumMarch 30, 2026Suyu Fan, Weiyi Zhou, Xuming Hu, Yingjie Gu, Guangzhong Peng, Yu Zhang, Wenming Zhao, Guohong Chen, Qi Xuin vitro transcription was performed using the T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S), and RNA purification was performed by a Monarch RNA Cleanup Kit (New England Biolabs, T2040). The

Write a Review

(1)

7/23/2023RNA Synthesis Kit From NEB Ganesh PusapatiThe WNT pathway is essential for embryonic development and adult tissue homeostasis. Deregulation of this pathway results in cancers of the stomach, intestine, breast, etc. I am interested in studying... Read Review
(1)

4/26/2022Great RNA Synthesis Kit Nan WangThis is high fidelity RNA synthesis kit from New England Biolabs. The synthesized RNA can be used for in vivo microinjection to achieve the RNAi effect.

HiScribe T7 High Yield RNA Synthesis Kit

HiScribe T7 High Yield RNA Synthesis Kit from New England Biolabs

New England Biolabs

Citations (556)

Reviews

HiScribe T7 High Yield RNA Synthesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map