HiScribe T7 High Yield RNA Synthesis Kit E2040S from New England Biolabs

Product Specs
ItemHiScribe T7 High Yield RNA Synthesis Kit
CompanyNew England Biolabs
Price $244.00 Inquire
Catalog NumberE2040S
Quantity50 reactions
ApplicationsFunctional Genomics
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(21) Prokaryotic Schlafen proteins cleave tRNAs during type III CRISPR immunityNature CommunicationsJuly 2, 2026Pedro Weickert, Yang Liu, Jonathan StreckerE. coli genomic DNA) were in vitro transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S) and purified with RNA Clean XP beads (Beckman Colter, A63987). Isoleucin tRNA variants were generated

(22) Reciprocal compensation of caspase-2 and p53 regulates the DNA damage response in HCT116 colon cancer cellsJournal of Biological ChemistryJuly 1, 2026Karla E. Lopez, Leslie Bandera, Luiza E. Coutinho, Karen Zúñiga, Sarah Wright, Lisa Bouchier-Hayesby in vitro transcription using the HiScribe T7 high yield RNA synthesis kit (New England Biolabs #E2040S), and RNA was purified using the RNA purification kit (Zymo Research #R1017). 0). Purified sgRNA (0.5

(23) The temporal architecture of the seminiferous epithelial cycle revealed by spatial transcriptomicsCellJune 25, 2026Arun Chakravorty, Jina Yun, Henry Amrhein, Katsuya L. Colón, Toshiyuki Sato, Benjamin D. Simons, Shosei Yoshida, Long Caimanufacturer’s instructions. The PCR products were used as the template for in vitro transcription (E2040S; NEB) followed by reverse transcription (EP7051; Thermo Fisher). After reverse transcription, the probes

(24) Engineering drug-responsive replication machinery for precise control of self-amplifying RNANature Biomedical EngineeringJune 23, 2026Parisa Yousefpour, Justin R. Gregory, Kristen Si, Jan Lonzaric, Yingzhong Li, Junmin Wang, Kashif Qureshi, Amir Ledbetter, Mariane B. Melo, Alexander Hostetler, et al.in vitro transcription (IVT) reactions were performed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB #E2040S) with 1–2μg of linear DNA template, scaled as needed. The IVT product was purified using PureLink RNA

(25) Quantitative profiling of RNA modifications enriched in non-membrane-bound cellular structures using APEX-RNA-MSCell Chemical BiologyJune 22, 2026Kyung W. Seo, Dhruv Y. Dhingani, Ralph E. KleinerM0212S). In vitro transcription (IVT) was done using HiScribe T7 High Yield RNA Synthesis kit (NEB, E2040S) and all IVT products were gel purified. For tRNA transfection, 0.3 x 106 HeLa cells were seeded per

(26) Neuronal YTHDF2 suppresses innate immune activation in Aβ pathology by promoting m6A-dependent decay of cytosolic mitochondrial mRNAsSci AdvJune 19, 2026Wenqi Pan, Lin Yang, Yao Zhang, Yan Chen, Yuesi Xu, Yifan Li, Yujie Fu, Chunhui Ma, Chunying Liu, Qing Li, et al.In vitro transcription In vitro RNA was synthesized via the HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S) following the manufacturer’s instructions. The plasmid template (pGEM-T–mt-Nd4) was synthesized by

(27) Rational design of a modular mRNA vaccine platform for rapid adaptation to SARS-CoV-2 variantsSci RepJune 3, 2026Julia Rudert, Julia Volckmar, Andreas Jeron, Maike Bälkner, Pia Grimpe, Henning Jacobsen, Dandan Zhang, Giovana Bavia Bampi, Luka Cicin-Sain, Dunja Bruder, et al.GenScript. mRNAs were produced using the HiScribe® T7 High Yield RNA Synthesis Kit (New England BioLabs, E2040S) following the manufacturer’s protocol, with minormodifications. In each reaction, uridine was replaced

(28) Fully Modified SpyCas9 Guide RNAs Enable Robust Genome Editing In Cells and In VivobioRxivMay 29, 2026Kim Anh Vu, Han Zhang, Nadia Amrani, Gitali Devi, Nicholas Gaston, Jonathan Lee, Stacy A. Maitland, Zexiang Chen, Dimas M. Escheverria, PengPeng Liu, et al.was synthesized by in vitro transcription (IVT) using HiScribe T7 high-yield RNA synthesis kit (NEB, E2040S). CleanCap AG (3’OMe) and N1-Methyl-Pseudouridine-5’-Triphosphate were obtained from TriLink (N-7413-1

(29) Microinjected dsRNA triggers a robust RNAi response in Stentor coeruleusMicroPubl BiolMay 27, 2026Makenna Kuecks, Preeti Arra, Sarah Hoffmann-Weitsman, Makenzie Funk Craig, Mark M SlabodnickIn vitro transcription was performed using a HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs; E2040S) following the manufacturer’s standard protocol. Finally, the dsRNA was resuspended in either water,

(30) Hepatic SNHG9 links gut microbiota to liver protection in drug-induced liver injuryNat CommunMay 20, 2026Wu Bao, Bingqing Hang, Danyi Zeng, Jiajie Mao, Li-Bin Pan, Lichao Wang, Guangyi Xu, Meng Wang, Kailin Liu, Xianjiong Chen, et al.assay In vitro transcription of RNA was performed using the HiScribe T7 High Yield RNA Synthesis Kit (Cat#E2040S; NEB), followed by purification via phenol:chloroform extraction. For RNA labeling, 50 pmol of purified

(31) DNA-guided CRISPR–Cas12 for cellular RNA targetingNature BiotechnologyMay 15, 2026Carlos Orosco, Boyu Huang, Santosh R. Rananaware, August P. Bodin, Ivy Browning, Anne Fang, Michael P. Baugh, Ian H. Lange, Yasmin B. Elhabashy, Mahika Balaraju, et al.from Twist Biosciences and in vitro transcribed using HiScribe T7 high-yield RNA synthesis kit (NEB, E2040S) to generate the long RNA fragments. CRISPR–Cas-based fluorescence detection assay Fluorescence-based

(32) Protocol for covalent RNA labeling by RiboLight dyes for detection by in-gel fluorescence and fluorescence microscopySTAR ProtocMay 14, 2026Moon Jung Kim, Jinwoo Shin, Eric T. KoolClean & Concentrator-5,Zymo,Cat#1013 HiScribe® T7 High Yield RNA Synthesis Kit,New England Biolabs,Cat#E2040S ,, Experimental models: Cell lines,Experimental models: Cell lines,Experimental models: Cell lines ,, HeLa,ATCC

(33) roX1 and roX2 lncRNAs promote heterochromatinization in intestinal stem cells and impair longevityEMBO ReportsMay 9, 2026Kai-Le Li, Chen Wang, Yong-Hao Li, Bo Peng, Li Zheng, Qinyun Che, Xin-Yi Lu, Donglin Li, Yu-Tong Li, Hui-Min Wei, et al.single-stranded RNA (ssRNA) was synthesized utilizing the HiScribe T7 High Yield RNA Synthesis Kit (NEB, E2040S). This ssRNA then undergoes annealing to form double-stranded RNA (dsRNA). The RNAi experiment was conducted

(34) Generation of precise and accurate engineered circRNAs using enzymatic ligationNucleic Acids ResMay 8, 2026Amrita Singh, Adela Dujsikova, Noah Mueller, Y Grace ChenNTPs, 1× of T7 reaction buffer, and 2 µL of T7 RNA polymerase enzyme at 37°C for either 2 or 16 h (NEB #E2040S). The addition of 2 units of Turbo DNase (Invitrogen #AM2238) per transcription reaction at 37°C for

(35) Structural basis of RNA-guided transcription by a dCas12f–σE–RNAP complexNatureMay 7, 2026Renjian Xiao, Florian T. Hoffmann, Dan Xie, Tanner Wiegand, Adriana I. Palmieri, Samuel H. Sternberg, Leifu Chang150-nt, 100-nt, and 50-nt RNA products, using the HiScribe® T7 High Yield RNA Synthesis Kit (NEB # E2040S) and radiolabeled NTPs as described above. The in vitro transcription of control ecoRNAP-σ70 was performed

(36) Novel mouse line with D277N mutation in the Plau gene displays autism spectrum disorder-like traitsFront Cell Dev BiolMay 6, 2026Maxim Karagyaur, Olga Averina, Kirill Bozov, Stalik Dzhauari, Anastasia Priymak, Raushana Khaybullina, Oleg Permyakov, Vladimir Popov, Olga Grigorieva, Maria Illarionova, et al.5′-TGGAGCAGCTCATCTTGCACGAATACTACAGGGAAGACAGCCTGGCCTACCATAATAATATTGGTGAGCAGAAAGCTTAGTTACCAGAAAGGCTAAAGTAGTGGTGGGAAA-3’. To synthesize guide RNAs we used HiScribe T7 High Yield RNA Synthesis Kit (NEB, #E2040S) and the DNA matrix obtained using Phanta Max Super-Fidelity DNA Polymerase kit (Vazyme, #P505-d3),

(37) A kinetic approach for mapping seed regions of CRISPR ribonucleoprotein and improving specificityNucleic Acids ResearchMay 4, 2026Wei Feng, Jianyu Hu, Hongquan Zhang, X Chris Leused as the template for 20 µl T7 transcription using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, #E2040S). RNA was treated with DNase I (NEB, #M0303S), purified with TRIzol Reagent (Thermo Fisher Scientific,

(38) Molecular insights into DDX3X–androgen receptor mRNA regulation via non-canonical G-quadruplex in castration-resistant prostate cancerOncogeneMay 4, 2026Han Zhang, Teresa T. Liu, Feixuan Wu, Avan N. Colah, Emily A. Ricke, Lingjun Li, Andrea A. Putnam, William A. Ricke(TAATACGACTCACTATAGGGAATTTTTCCTTCGGAATTTATCAATAGTGC; ordered from IDT) using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S) and subsequently biotinylated with the Pierce RNA 3’ End Biotinylation Kit (Thermo Scientific, 20160).

(39) Plant-associated fungi co-opt ancient antimicrobials for host manipulationSci AdvApril 29, 2026Fantin Mesny, Valentina Wolf, Ana López-Moral, Anton Kraege, Wilko Punt, Saifei Liu, Jinyi Zhu, Jiyeun Park, Yukiyo Sato, Bart P. H. J. Thomma(25 mM each), 1.5 μl of T7 buffer (10×), 1.5 μl of HiScribe T7 polymerase (New England Biolabs; ref. E2040S), 1 μl of dithiothreitol (0.1 M), and nuclease-free water up to 20 μl total volume. After incubation

(40) Circular mRNA against CleanCap linear mRNA vectors: comprehensive comparison, expression, active and passive immunizationFrontiers in ImmunologyApril 24, 2026Vladimir M. Vakhtinskii, Irina L. Tutykhina, Alina S. Dzharullaeva, Daria M. Grousova, Ilya D. Zorkov, Anna A. Ilyukhina, Dmitrii A. Reshetnikov, Valentin V. Azizyan, Artem A. Derkaev, Evgeniia N. Bykonia, et al.produced via in vitro transcription (IVT) using the HiScribe T7 High Yield mRNA Synthesis Kit (NEB #E2040S) according to the manufacturer`s recommendations. The reaction mix for circular mRNA contained canonical

Write a Review

(1)

7/23/2023RNA Synthesis Kit From NEB Ganesh PusapatiThe WNT pathway is essential for embryonic development and adult tissue homeostasis. Deregulation of this pathway results in cancers of the stomach, intestine, breast, etc. I am interested in studying... Read Review
(1)

4/26/2022Great RNA Synthesis Kit Nan WangThis is high fidelity RNA synthesis kit from New England Biolabs. The synthesized RNA can be used for in vivo microinjection to achieve the RNAi effect.

HiScribe T7 High Yield RNA Synthesis Kit

HiScribe T7 High Yield RNA Synthesis Kit from New England Biolabs

New England Biolabs

Citations (572)

Reviews

HiScribe T7 High Yield RNA Synthesis Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map