psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(341) Tumour suppressive microRNA-874 regulates novel cancer networks in maxillary sinus squamous cell carcinomaBritish journal of cancerSeptember 6, 2011Nohata N, Hanazawa T, Kikkawa N, Sakurai D, Fujimura L, Chiyomaru T, Kawakami K, Yoshino H, Enokida H, Nakagawa M, et al.inserted between the XhoI–PmeI restriction sites in the 3-UTR of the hRluc gene in psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). Sequences of oligonucleotides are described in the Supplementary Information.

(342) Targeting of microRNA-142-3p in dendritic cells regulates endotoxin-induced mortalityBloodJune 9, 2011Sun Y, Varambally S, Maher CA, Cao Q, Chockley P, Toubai T, Malter C, Nieves E, Tawara I, Wang Y, et al.containing both firefly luciferase gene and Renilla luciferase gene, was obtained from Promega (Catalog No. C8021). miRNA target sequences (Fig. 2A) were inserted between the XhoI–Not I restriction sites in the multiple cloning

(343) Glutathione S-transferase P1 (GSTP1) suppresses cell apoptosis and its regulation by miR-133α in head and neck squamous cell carcinoma (HNSCC)International Journal of Molecular MedicineMarch 1, 2011Muradil Mutallip et al.between the XhoI– PmeI restriction sites in the 3'UTR of the hRluc gene in the psiCHECK™-2 vector (C8021; Promega, Madison, WI, USA). Primer sequences for the full-length 3'UTR of GSTP1 mRNA (TAGGCGATCGCTCGAGGGGTTGGGGGGACTCTGA

(344) Specificity and functionality of microRNA inhibitorsSilenceDecember 1, 2010Barbara Robertson, Andrew B Dalby, Jon Karpilow, Anastasia Khvorova, Devin Leake, Annaleen Vermeulenthe test inhibitor molecule and the respective dual luciferase reporter or control plasmid (cat. no. C8021; psiCHECK™-2; Promega, Foster City, CA, USA) were co-transfected into cells using transfection reagents

(345) MicroRNA miR-137 regulates neuronal maturation by targeting ubiquitin ligase mind bomb-1Stem CellsJune 1, 2010Smrt RD, Szulwach KE, Pfeiffer RL, Li X, Guo W, Pathania M, Teng ZQ, Luo Y, Peng J, Bordey A, et al.products were cloned into XhoI- and NotI-digested psiCHECK-2 dual luciferase vector (Promega, Cat# C8021) and were later transferred by XhoI/NotI double digestion and T4 DNA ligation into a pIS2 renilla luciferase

(346) miR-145 and miR-133a function as tumour suppressors and directly regulate FSCN1 expression in bladder cancerBritish Journal of CancerMarch 2, 2010T Chiyomaru, H Enokida, S Tatarano, K Kawahara, Y Uchida, K Nishiyama, L Fujimura, N Kikkawa, N Seki, M Nakagawainserted between the XhoI–PmeI restriction sites in the 30 -UTR of the hRluc gene in psiCHECK-2 vector (C8021, Promega, Madison, WI, USA). BOY cells were transfected with 5 ng of vector, 10 nM of microRNAs, and

(347) A novel reverse transduction adenoviral array for the functional analysis of shRNA librariesBMC GenomicsDecember 1, 2008Angelika Oehmig et al.the humanized Renilla luciferase gene and a synthetic polyadenylation site of plasmid psiCHECK™-2 (C8021, Promega, Genebank accession # AY535007). Depending on the presence of suitable restriction sites upstream

(348) Design and delivery of antisense oligonucleotides to block microRNA function in cultured Drosophila and human cellsNature ProtocolsOctober 1, 2008Michael D Horwich, Phillip D ZamoreMedia (Invitrogen, 11965) • Trypsin-EDTA Solution (Invitrogen, 12605) • psiCheck 2 Vector (Promega, C8021) • Sterile 24-well Dishes (Beckton Dickinson, 35 3047) • Sterile 6-well Dishes (Beckton Dickinson,

(349) Double-stranded regions are essential design components of potent inhibitors of RISC functionRNAMay 1, 2007Annaleen Vermeulen, Barbara Robertson, Andrew B Dalby, William S Marshall, Jon Karpilow, Devin Leake, Anastasia Khvorova, Scott Baskerville(hRluc), each with its own promoter and poly(A)-addition sites, was obtained from Promega (Catalog No. C8021). miRNA target sequences were inserted between the XhoI– Not I restriction sites in the multiple cloning

(350) miR-1 as a tumor suppressive microRNA targeting TAGLN2 in head and neck squamous cell carcinomaOncotargetJanuary 1, 0001"Nohata N, Sone Y, Hanazawa T, Fuse M, Kikkawa N, Yoshino H, Chiyomaru T, Kawakami K, Enokida H, Nakagawa M, et al."inserted between the XhoI–PmeI restriction sites in the 3'UTR of the hRluc gene in the psiCHECK™-2 vector (C8021; Promega, Madison, WI, USA). Primer sequences for full-length 3'UTR of TAGLN2 mRNA (ATCGCTCGAGACAGATGGGCACCAACCGCG

(351) The microRNA-23b/27b/24-1 cluster is a disease progression marker and tumor suppressor in prostate cancerOncotargetJanuary 1, 0001"Goto Y, Kojima S, Nishikawa R, Enokida H, Chiyomaru T, Kinoshita T, Nakagawa M, Naya Y, Ichikawa T, Seki N."inserted between the XhoI–PmeI restriction sites in the 3'UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). The protocol for vector construction was described previously [15, 38,

(352) NF-κB-induced microRNA-31 promotes epidermal hyperplasia by repressing protein phosphatase 6 in psoriasisNature communicationsJanuary 1, 0001Yan S, Xu Z, Lou F, Zhang L, Ke F, Bai J, Liu Z, Liu J, Wang H, Zhu H, et al.well. For 3′ UTR reporter assay, 3′ UTR fragments of ppp6c were cloned into psiCHECK-2 vector (Promega, #C8021). Site-specific mutant was generated by PCR. The following primers were used: Ppp6c, forward primer,

(353) Multi-omics analyses integration reveals a novel TRF2-miR-181a-5p-S100A10 regulatory axis in colon cancerCellular & molecular biology lettersJanuary 1, 0001"Dinami R, Petti E, Ostano P, Iachettini S, Rizzo A, Maresca C, Zizza P, Di Vito S, Porru M, D'Angelo C, et al."electrophoresis, purified from the gel by commercial kit (Qiagen), and then, cloned into psiCHECK-2 vector (#C8021; Promega) as previously described [9]. The mutagenesis of the binding site of miR-181-5p on the 5′UTR

(354) MicroRNA expression signature of castration-resistant prostate cancer: the microRNA-221/222 cluster functions as a tumour suppressor and disease progression markerBritish journal of cancerJanuary 1, 0001"Goto Y, Kojima S, Nishikawa R, Kurozumi A, Kato M, Enokida H, Matsushita R, Yamazaki K, Ishida Y, Nakagawa M, et al."inserted between the XhoI–PmeI restriction sites in the 3′ UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). The protocol for vector construction was described previously (Kinoshita

(355) Genome-wide CRISPR/Cas9 screening identifies a targetable MEST-PURA interaction in cancer metastasisEBioMedicineJanuary 1, 0001"Xu WW, Liao L, Dai W, Zheng CC, Tan XP, He Y, Zhang QH, Huang ZH, Chen WY, Qin YR, et al."of MEST. The MEST 3′-UTR was cloned into the psiCHECK-2 reporter vector (Promega, Madison, WI, USA, C8021), and mutant variants of the MEST 3′-UTR were created using the QuikChange Lightning Site-Directed Mutagenesis Kit

(356) A quantitative method to identify microRNAs targeting a messenger RNA using a 3'UTR RNA affinity techniqueAnalytical biochemistryJanuary 1, 0001"Shi M, Han W, Spivack SD."R0189S) digestion, the fragment of TCF8 3′UTR was cloned into psiCHECK-2 vector (Promega, cat. no. C8021) provided by the Hayley McDaid laboratory. The fragment of the 3′UTR of Smad4 was amplified from the

(357) Vitamin D Supplementation Rescues Aberrant NF-κB Pathway Activation and Partially Ameliorates Rett Syndrome Phenotypes in Mecp2 Mutant MiceeNeuroJanuary 1, 0001Ribeiro MC, Moore SM, Kishi N, Macklis JD, MacDonald JL.co-transfected Renilla luciferase construct, derived from the psiCHECK-2 vector (Promega, catalog #C8021) with the HSV-TK promoter and Firefly luciferase cut out by digestion with NotI and XbaI. Embryonic

(358) The microRNA expression signature of bladder cancer by deep sequencing: the functional significance of the miR-195/497 clusterPloS oneJanuary 1, 0001"Itesako T, Seki N, Yoshino H, Chiyomaru T, Yamasaki T, Hidaka H, Yonezawa T, Nohata N, Kinoshita T, Nakagawa M, et al."inserted between the XhoI-PmeI restriction sites in the 3′-UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). BOY cells were transfected with 15 ng vector, ten nM miRNAs (Pre-miR™ or

(359) MicroRNA-33 inhibition ameliorates muscular dystrophy by enhancing skeletal muscle regenerationEMBO molecular medicineJanuary 1, 0001"Sowa N, Horie T, Ide Y, Baba O, Kora K, Yoshida T, Nakamura Y, Matsumura S, Matsushita K, Imanaka M, et al."10.1038/srep05312.,Originally generated Recombinant DNA,Recombinant DNA,Recombinant DNA psiCHECK-2,Promega,C8021 Antibodies,Antibodies,Antibodies Anti-CDK6,CST,#3136 Anti-ABCA1,Novus,NB400-105 Anti-PAX7,DSHB,DSHB-PAX7-SA-5 Anti-Utrophin,Santa cruz

(360) Cardiac telocytes inhibit cardiac microvascular endothelial cell apoptosis through exosomal miRNA-21-5p-targeted cdip1 silencing to improve angiogenesis following myocardial infarctionTheranosticsJanuary 1, 0001"Liao Z, Chen Y, Duan C, Zhu K, Huang R, Zhao H, Hintze M, Pu Q, Yuan Z, Lv L, et al."sequences from the 3' untranslated regions (3'UTRs) of the Cdip1 mRNAs into the psiCHECK-2 vector (cat. no. C8021, Promega). Briefly, the wild-type 3' UTR of the Cdip1 gene, which contains the predicted miR-21 response

Be the First to Write a Review!