psiCHECK-2 Vector from Promega

Product Specs
ItempsiCHECK-2 Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberC8021
Hostmammalian cell line of choice
PromoterSV40 early enhancer/promoter
ResistanceAmp
Quantity20microg
Molecular Weight~78kDa
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable Marker (standardized)Ampicillin
Vector NamepsiCHECK-2

Specifications/Features

Vector Size:
~6.3 kb

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(321) Dual regulation of receptor tyrosine kinase genes EGFR and c-Met by the tumor-suppressive microRNA-23b/27b cluster in bladder cancerInternational Journal of OncologyFebruary 1, 2015TAKESHI CHIYOMARU et al.XhoI-PmeI restriction sites in the 3′-untranslated region (UTR) of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). miRNA target sequences targeted by miR-23b and miR-27b are summarized in

(322) Short loop-targeting oligoribonucleotides antagonize Lin28 and enable pre-let-7 processing and suppression of cell growth in let-7-deficient cancer cellsNucleic acids researchJanuary 1, 2015Roos M, Rebhan MA, Lucic M, Pavlicek D, Pradere U, Towbin H, Civenni G, Catapano CV, Hall J.from Microsynth (Balgach) and cloned into the NotI and XhoI restriction sites of psiCHECK-2 plasmid (C8021; Promega, Fitchburg). The primers used for cloning as well as the inserted sequences in the psiCHECK2

(323) HIV-1 Tat C modulates NOX2 and NOX4 expressions through miR-17 in a human microglial cell lineJournal of NeurochemistryDecember 1, 2014Vaishnavi Sunil Jadhav, Karl-Heinz Krause, Sunit K. SinghLuciferase reporter assay Luciferase reporter clones of intact sequences WT NOX2 30 UTR (cloned in psiCHECK-2 Vector, #C8021; Promega, Madison, WI, USA), WT NOX4 30 UTR (#HmiT054569-MT01; GeneCopeia), mutant-NOX2 30 UTR clone,

(324) miR-34a regulates mesangial cell proliferation via the PDGFR-β/Ras-MAPK signaling pathwayCellular and molecular life sciences : CMLSOctober 1, 2014Chen D, Li Y, Mei Y, Geng W, Yang J, Hong Q, Feng Z, Cai G, Zhu H, Shi S, et al.targeting sequence, was cloned into the psiCHECK dual-luciferase reporter plasmid (Promega, USA; cat. no. C8021) to produce psiCHECK-WT-PDGFR-β, psiCHECK-WT-cyclin E, or psiCHECK-WT-CDK2, respectively, using PCR.

(325) Angiotensin II-regulated microRNA 483-3p directly targets multiple components of the renin-angiotensin systemJournal of molecular and cellular cardiologyOctober 1, 2014Kemp JR, Unal H, Desnoyer R, Yue H, Bhatnagar A, Karnik SS.luciferase reporter expression vector, which contains unique Xho1 and Not1 restriction sites (Cat. No. C8021; Promega, WI, USA). Genomic DNA was isolated from human kidney epithelial (HEK-293) cells using a DNeasy

(326) Embryonic stem cell-specific microRNAs contribute to pluripotency by inhibiting regulators of multiple differentiation pathwaysNucleic acids researchAugust 1, 2014Gruber AJ, Grandy WA, Balwierz PJ, Dimitrova YA, Pachkov M, Ciaudo C, Nimwegen Ev, Zavolan M.mutated, were verified by sequencing and then subcloned into the empty psiCHECK-2 vector (Promega; C8021) at XhoI - NotI restriction sites. The sequences of the primers used for cloning and mutagenesis can

(327) Tumor‐suppressive micro RNA ‐218 inhibits cancer cell migration and invasion via targeting of LASP 1 in prostate cancerCancer ScienceJuly 1, 2014Rika Nishikawa et al.inserted between the XhoI–PmeI restriction sites in the 3′-UTR of the hRluc gene in the psiCHECK-2 vector (C8021 [Promega, Madison, WI, USA]). The protocol for vector construction was as described previously.(16)

(328) Tumor-suppressive microRNA-29s inhibit cancer cell migration and invasion via targeting LAMC1 in prostate cancerInternational Journal of OncologyJuly 1, 2014RIKA NISHIKAWA et al.inserted between the XhoI-PmeI restriction sites in the 3'-UTR of the hRluc gene in the psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). PC3 cells were transfected with 5 ng of the vector and 10 nM miR-29s using

(329) MicroRNA-26a regulates glucose metabolism by direct targeting PDHX in colorectal cancer cellsBMC cancerJune 16, 2014Chen B, Liu Y, Jin X, Lu W, Liu J, Xia Z, Yuan Q, Zhao X, Xu N, Liang S.PDHX mRNA was cloned in the downstream of the Renilla luciferase gene in the psiCHECK-2 vector (Cat. # C8021, Promega, USA), which contains a reporter gene Renilla luciferase and an intraplasmid transfection normalization

(330) Multiple microRNAs derived from chemically synthesized precursors regulate thrombospondin 1 expressionNucleic acid therapeuticsApril 1, 2014Dogar AM, Semplicio G, Guennewig B, Hall J.instructions. Cloning of THBS1 3 ¢UTR THBS1 3¢UTR was cloned into the dual luciferase plasmid psiCHECK2 (No. C8021, Promega) by digestion with Not1 and Xho1 restriction enzymes. The inserts were cloned into the multiple

(331) Miravirsen (SPC3649) can inhibit the biogenesis of miR-122Nucleic acids researchJanuary 1, 2014Gebert LF, Rebhan MA, Crivelli SE, Denzler R, Stoffel M, Hall J.purified, digested and ligated into the previously digested and dephosphorylated psiCHECK-2 plasmid (C8021, Promega, Fitchburg). The ligated fragment was transformed into Subcloning Efficiency™ DH5α™ Competent

(332) Tumour-suppressive microRNA-29s inhibit cancer cell migration and invasion by targeting laminin–integrin signalling in head and neck squamous cell carcinomaBritish Journal of CancerNovember 12, 2013T Kinoshita et al.inserted between the XhoI–PmeI restriction sites in the 3′-UTR of the hRluc gene in psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). The same was done with the partial wild-type sequences of the ITGA6 3′-UTR

(333) MiR-26b, upregulated in Alzheimer's disease, activates cell cycle entry, tau-phosphorylation, and apoptosis in postmitotic neuronsThe Journal of neuroscience : the official journal of the Society for NeuroscienceSeptember 11, 2013Absalon S, Kochanek DM, Raghavan V, Krichevsky AM.DIV. Validation of miR-26b target. miR-26b targets were validated using psiCHECK2 constructs (Promega C8021). Nucleotides 494 –1156 of human Rb1 3⬘ UTR were cloned into psiCHECK2 using XhoI and NotI. Mutations

(334) Tumour-suppressive microRNA-874 contributes to cell proliferation through targeting of histone deacetylase 1 in head and neck squamous cell carcinomaBritish journal of cancerApril 30, 2013Nohata N, Hanazawa T, Kinoshita T, Inamine A, Kikkawa N, Itesako T, Yoshino H, Enokida H, Nakagawa M, Okamoto Y, et al.inserted between the XhoI–PmeI restriction sites in the 3′-UTR of the hRluc gene in psiCHECK-2 vector (C8021; Promega, Madison, WI, USA). Sequences of oligonucleotides were described in Supplementary document

(335) Comprehensive expression analyses of neural cell-type-specific miRNAs identify new determinants of the specification and maintenance of neuronal phenotypesThe Journal of neuroscience : the official journal of the Society for NeuroscienceMarch 20, 2013Jovičić A, Roshan R, Moisoi N, Pradervand S, Moser R, Pillai B, Luthi-Carter R.construct preparation. 3⬘-UTRs were cloned into the multiple cloning site of psiCHECK-2 vector (catalog #C8021; Promega). 3⬘-UTR sequences were retrieved from TargetScan and primers were designed to amplify full-length

(336) Dynamics of 5-Hydroxymethylcytosine and Chromatin Marks in Mammalian NeurogenesisCell ReportsFebruary 21, 2013Maria A. Hahn et al.

(337) MiR-34 modulates Caenorhabditis elegans lifespan via repressing the autophagy gene atg9Age (Dordrecht, Netherlands)February 1, 2013Yang J, Chen D, He Y, Meléndez A, Feng Z, Hong Q, Bai X, Li Q, Cai G, Wang J, et al.(ACTGCC) was cloned into the psiCHECKTM-2 dual luciferase reporter plasmid (Promega, USA; cat. no. C8021) to produce psiCHECK-WT-Atg9A using PCR. 5′-ACTGCC-3′ (285–291 bp) in 3′-UTR of Atg9A, the core binding sequence

(338) MicroRNA-22 (miR-22) Overexpression Is Neuroprotective via General Anti-Apoptotic Effects and May also Target Specific Huntington’s Disease-Related MechanismsPLoS ONEJanuary 17, 2013Ana Jovicic, Julien Francisco Zaldivar Jolissaint, Roger Moser, Mariana de Fatima Silva Santos, Ruth Luthi-Carter3′ UTRs were cloned into the multiple cloning site of the psiCHECK™-2 vector (Promega, Cat. number C8021). 3′ UTR sequences were retrieved from TargetScan and primers were: F-HDAC4-3′ UTR: ataagtcgacaagctgctgttctctcctttgt,

(339) Functional divergence of the rapidly evolving miR-513 subfamily in primatesBMC evolutionary biologyJanuary 1, 2013Zhenghua Sun, Yanfeng Zhang, Rui Zhang, Xuebin Qi, Bing Sutesting. DNA constructs All the constructs for this study were derived from psiCHECK™-2 vector (Promega, C8021). Human 3′UTR sequences were amplified from genomic DNA of human white blood cells using PCR. The oligonucleotide

(340) An epigenetic feedback regulatory loop involving microRNA-195 and MBD1 governs neural stem cell differentiationPloS oneJanuary 1, 2013Liu C, Teng ZQ, McQuate AL, Jobe EM, Christ CC, von Hoyningen-Huene SJ, Reyes MD, Polich ED, Xing Y, Li Y, et al.PCR products were cloned into XhoI and NotI digested psiCHECK-2 dual luciferase vector (Promega, Cat# C8021). The constructs were co-transfected with small RNAs into aNSCs using FuGene HD transfection reagent

Be the First to Write a Review!