CTDSPL shRNA Plasmid (h) from Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

(1) miR-100-5p Enhances Cell Cycle-Mediated Chemoresistance by Modulating the CTDSPL/pRB/E2F1 Signaling Pathway in Oxaliplatin-Resistant Colorectal Cancer CellsOncology ResearchMarch 23, 2026Yen-Pin Chen, Rathinasamy Baskaran, Hema Sri Devi, Chaouhan Hitesh Singh, Yu-Jung Lin, Marthandam Asokan Shibu, Wei-Wen Kuo, Shih-Chieh Liao, Ming-Cheng Chen, Tso-Fu Wang, et al.and inhibitor NC: CAGUACUUUUGUGUAGUACAA), (GeneDireX Inc., Las Vegas, NV, USA) and sh-RNA; sh-CTDSPL (sc-78502), sh-FOXP3 (sc-43569), sh-CEBP-b (sc-44251) and sh-GATA-1 (sc-29330) (Santa Cruz Biotechnology, Inc., Santa

(2) MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cellsPloS oneJanuary 1, 2013Chen D, Chen Z, Jin Y, Dragas D, Zhang L, Adjei BS, Wang A, Dai Y, Zhou X.

CTDSPL shRNA Plasmid (h)