ASF1B shRNA Plasmid (m) from Santa Cruz Biotechnology, Inc. | Biocompare.com

Supplier Images
Published Figures

ASF1B shRNA Plasmid (m)

Be the first to write a review!

Citations:

Figures:

Supplier Page from
Santa Cruz Biotechnology, Inc. for
ASF1B shRNA Plasmid (m)

Product Specs
ItemASF1B shRNA Plasmid (m)
CompanySanta Cruz Biotechnology, Inc.
Price $592.00Supplier Page View Company Product Page
Catalog Numbersc-72564-SH
RNA TypeshRNA Clones
Vector Type (Standardized)Lentiviral
TypeshRNA Plasmid
Speciesmouse
NCBI Full Gene Nameanti-silencing function 1B histone chaperone
NCBI Gene Aliases1700003K02Rik, CIA-II
Quantity20 µg

Add to Compare List

Santa Cruz Biotechnology, Inc.

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Lactobacillus plantarum-derived indole-3-lactic acid inhibits prostate cancer progression through ASF1B/ENO1 axis and remodels the tumor microenvironment to enhance anti-PD-1 therapyMol BiomedAugust 6, 2026Zhengshi Wang, Chengyou Jia, Yongqiang Liu, Youlutuziayi Rixiati, Wentao Zhang, Shiyu Mao, Haotian Chen, Libin Zou, Chen Ye, Bing Shen, et al.sequence (GTGGGCTACTATGTCAACAAT) was obtained from Sigma-Aldrich, and an additional sh-Asf1b-2 plasmid (sc-72564-SH) was purchased from Santa Cruz to reduce off-target effects. For ASF1B overexpression, the pcDNA3.1-ASF1B

Be the First to Write a Review!