Brn-3a shRNA Plasmid (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemBrn-3a shRNA Plasmid (h)
CompanySanta Cruz Biotechnology, Inc.
Price $592.00Supplier Page View Company Product Page
Catalog Numbersc-29839-SH
Quantity20 µg
RNA TypeshRNA Clones
Vector Type (Standardized)Lentiviral
TypeshRNA Plasmid
Specieshuman
NCBI Full Gene NamePOU class 4 homeobox 1
NCBI Gene AliasesATITHS, BRN3A, Oct-T1, RDC-1, brn-3A

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Identifying and evaluating a disulfidptosis-related gene signature to predict prognosis in colorectal adenocarcinoma patientsFrontiers in ImmunologyJune 19, 2024Ming Li, Jin Wang, Yuhao Zhao, Changjie Lin, Jianqing Miao, Xiaoming Ma, Zhenyu Ye, Chao Chen, Ke Tao, Pengcheng Zhu, et al.follows: Forward: 5′ - ACGCACGAACTGAGTCGAAA - 3′Reverse: 5′-CACTTCCCGGGATTGGAGAG-3′ The POU4F1 shRNA plasmid (sc-29839-SH) was purchased from Santa Cruz Biotechnology. The transfection of plasmid vectors was carried out in

(2) Brn3a/Pou4f1 Functions as a Tumor Suppressor by Targeting c-MET/STAT3 Signaling in Thyroid CancerThe Journal of clinical endocrinology and metabolismSeptember 1, 2020Jung SN, Kang YE, Lee GH, Liu L, Oh C, Jin YL, Lim MA, Lee K, Oh T, Won HR, et al.

(3) POU4F1 promotes the resistance of melanoma to BRAF inhibitors through MEK/ERK pathway activation and MITF up-regulationCell death & diseaseJune 12, 2020Liu L, Yue Q, Ma J, Liu Y, Zhao T, Guo W, Zhu G, Guo S, Wang S, Gao T, et al.according control plasmid pCMV6-Entry ((PS100001) were purchased from ORIGENE. The POU4F1 shRNA plasmid (sc-29839-SH) was purchased from Santa Cruz biotechnology. Transfection of plasmid vectors was carried out in Opti-MEM

(4) Egr-1 and Hipk2 are required for the TrkA to p75(NTR) switch that occurs downstream of IGF1-RNeurobiology of agingDecember 1, 2009Li H, Costantini C, Scrable H, Weindruch R, Puglielli L.

Be the First to Write a Review!