Stealth RNAi siRNA Luciferase Reporter Control from Thermo Fisher Scientific

Product Specs
ItemStealth RNAi siRNA Luciferase Reporter Control
CompanyThermo Fisher Scientific
Price $262.00Supplier Page View Company Product Page
Catalog Number12935146
Quantity250 µL
Regulatory StatusFor Research Use Only. Not for use in diagnostic procedures
TypesiRNA
TargetLuciferase
Conjugate/Tag/LabelUnlabeled

Add to Compare List

Thermo Fisher Scientific

168 Third Avenue

Waltham, MA 02451

United States

Phone: 800-678-5599

Company Profile

Website: www.thermofisher.com

(1) Dual roles of TRPV2 in the innate immune response to cytosolic DNA: Arresting dormant and boosting activated STINGCell ReportsJanuary 27, 2026Chen Cheng, Hsiang-Ting Lu, Shan Li, Zhongsheng Youpaper,ACGTGGTGAGACTCCACTGT Stealth RNAi Luciferase Reporter Control (Control),Thermo Fisher,siRNA ID: 12935146 siRNA for TRPV2 #1,Thermo Fisher,GAACCTGCTTTACTATACA siRNA for TRPV2 #2,Thermo Fisher,CCCTAGTGATGATCTCGGA siRNA

(2) Targeting CaMKK2 Inhibits Actin Cytoskeletal Assembly to Suppress Cancer MetastasisCancer ResearchSeptember 1, 2023Debarati Mukherjee, Rebecca A. Previs, Corinne Haines, Muthana Al Abo, Patrick K. Juras, Kyle C. Strickland, Binita Chakraborty, Sandeep Artham, Regina S. Whitaker, Katherine Hebert, et al.(60,000 cells/mL), and HOC7 (75,000 cells/mL) cells were transfected with either control siRNAs (catalog #12935146, Thermo Fisher Scientific; catalog #SIC001, Millipore Sigma) or CaMKK2 siRNAs (50 nmol/L; catalog #10620318,

(3) Context-dependent pro- and anti-resection roles of ZKSCAN3 in the regulation of fork processing during replication stressJournal of Biological ChemistryAugust 1, 2022Zheng Yang, Delphine Sangotokun Lemacon, Shan Li, Abigael Cheruiyot, Lingzhen Kong, Ke Tan, Chen Cheng, Ecenur Turkay, Dalin He, Zhongsheng You(Thermo Fisher, s37206), cGAS (Thermo Fisher, s41746), and Control (negative control, Thermo Fisher, 12935146). siRNAs used for the ZKSCAN family screen are listed in Table 1. Nondenaturing BrdU immunofluorescence

(4) Role of high ubiquitin-conjugating enzyme E2 expression as a prognostic factor in nasopharyngeal carcinomaOncology lettersJune 1, 2022Kao WC, Hsu SH, Lin CL, Lin CY, Chen SW, Chen YX, Chen CH, Lee SW, Tsao CJ, Huang WT, et al.(8). In brief, NPC cells in the exponential growth phase were transfected with control siRNA (cat. no. 12935146; Thermo Fisher Scientific, Inc.) or siUBE2B (cat. no. 4390824; Thermo Fisher Scientific, Inc.) using

(5) FXR1 splicing is important for muscle development and biomolecular condensates in muscle cellsThe Journal of cell biologyApril 6, 2020Smith JA, Curry EG, Blue RE, Roden C, Dundon SER, Rodríguez-Vargas A, Jordan DC, Chen X, Lyons SM, Crutchley J, et al.manufacturer’s protocols. The siRNA sequences were as follows: (1) si-luc (luciferase reporter control, no. 12935146), 5′-GCACUCUGAUUGACAAAUACGAUU-3′ (sense) and 5′-AAAUCGUAUUUGUCAAUCAGAGUGC-3′ (antisense);

(6) Ca(2+)-Stimulated AMPK-Dependent Phosphorylation of Exo1 Protects Stressed Replication Forks from Aberrant ResectionMolecular cellJune 20, 2019Li S, Lavagnino Z, Lemacon D, Kong L, Ustione A, Ng X, Zhang Y, Wang Y, Zheng B, Piwnica-Worms H, et al.GATTTCGGATTATCTAATA 3’), CaMKK2 (5’ CTAGCTGATTGTTGTGGTCAA 3’), and luciferase (negative control, Thermo Fisher, 12935146) were used. Antibodies against human Exo1 or Exo1 pS746 were raised in rabbits in collaboration with

(7) PRSS21/testisin inhibits ovarian tumor metastasis and antagonizes proangiogenic angiopoietins ANG2 and ANGPTL4Journal of molecular medicine (Berlin, Germany)May 1, 2019Conway GD, Buzza MS, Martin EW, Duru N, Johnson TA, Peroutka RJ, Pawar NR, Antalis TM.(s223167; ThermoFisher) or 20nM of a nonspecific control (Stealth RNAi targeted against luciferase (12935146; ThermoFisher)) for up to 120 hrs. Knockdown of testisin in the cells was confirmed by qPCR. For silencing

(8) Modulation of alternative splicing of trafficking genes by genome editing reveals functional consequences in muscle biologyThe International Journal of Biochemistry & Cell BiologyDecember 1, 2018R. Eric Blue, Amrita Koushik, Nichlas M. Engels, Hannah J. Wiedner, Thomas A. Cooper, Jimena Giudice(ThermoFisher Scientific), following manufacturer protocols. siRNA sequences for the Luciferase reporter control (#12935146) were GCACUCUGAUUGACAAAUACGAUU (sense) and AAAUCGUAUUUGUCAAUCAGAGUGC (antisense). siRNA sequences for

(9) The histone variant macroH2A confers functional robustness to the intestinal stem cell compartmentPLOS ONESeptember 21, 2017Ryan James Cedeno, Angela Nakauka-Ddamba, Maryam Yousefi, Stephanie Sterling, Nicolae Adrian Leu, Ning Li, John R. Pehrson, Christopher Joachim Lengnermeasured at 570 nm. The Stealth RNAisTM (Thermo Fisher) employed were siLuciferase control (Thermo Fisher 12935146), siH2AFY (Thermo Fisher HSS114259) and the macroH2A1 isoform-specific siRNAs used were of the following

(10) Phosphorylation of NBR1 by GSK3 modulates protein aggregationAutophagyJune 1, 2014Nicot AS, Lo Verso F, Ratti F, Pilot-Storck F, Streichenberger N, Sandri M, Schaeffer L, Goillot E.in Table S2, were compared with a control siRNA targeting Luciferase (Life Technologies-Invitrogen, 12935146). Cells were seeded in 35-mm diameter tissue culture dishes and transfected with 40 pmol siRNA. A second

Be the First to Write a Review!

Stealth RNAi siRNA Luciferase Reporter Control from Thermo Fisher Scientific

Description

Thermo Fisher Scientific

Citations (10)

Reviews

Stealth RNAi siRNA Luciferase Reporter Control from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map