TrueGuide sgRNA, predeisgned, modified from Thermo Fisher Scientific

Product Specs
ItemTrueGuide sgRNA, predeisgned, modified
CompanyThermo Fisher Scientific
Price Supplier Page View Company Product Page
Catalog NumberA35533
Regulatory StatusFor Research Use Only. Not for use in diagnostic procedures
Quantity1.5 nmol
Applicationsin vitro transcription
TypesgRNA

Add to Compare List

Thermo Fisher Scientific

168 Third Avenue

Waltham, MA 02451

United States

Phone: 800-678-5599

Company Profile

Website: www.thermofisher.com

(1) CRISPR/Cas9 gene editing in hematopoietic stem and progenitor cells to accelerate the translation of cellular therapies and immunotherapiesJournal of Translational ResearchDecember 31, 2026Laura Falceto Falceto Font, Dan Jin, John Figg, Connor Francis, Kaytora Long-James, Jeffrey Drake, Alexandra Reid, Caitland Love, Brianna McDonald, David Hilferty, et al.purchased from the predesigned TrueGuide Synthetic gRNA database from ThermoFisher Scientific (cat. #A35533; CRISPR591728_SGM, CRISPR591748_SGM, CRISPR882880_SGM, and CRISPR882881_SGM). Electroporation conditions Electroporation

(2) Dendritic Cell Dysfunction Underlies Immune Escape After Adoptive Cellular Therapy in GlioblastomaCancers (Basel)August 18, 2026Dan Jin, Bayli DiVita, Alexandra Reid, Caitland Love, John W. Figg, Connor Francis, Laura Falceto Font, Kaytora Long-James, David Hilferty, Sofia Stansbury, et al.CRISPR Knocking Out HIF1α sgRNA were purchased from Thermo Fisher Scientific (Waltham, MA, USA, cat# A35533). 1.2 μg sgRNA and 3.8 µg Cas9 mRNA (Trilink Biotechnologies, San Diego, CA, USA, cat# L-7606-1000)

(3) Berberrubine, a Metabolite of Berberine, Attenuates Intestinal Barrier Dysfunction in Inflammatory Bowel Disease by Inhibiting STAT3Int J Mol SciJuly 16, 2026Ziying Wang, Wanhong Zhu, Airu Ma, Jiaqi Chen, Jiawei Tian, Jiaying Zheng, Kang Wu, Xia Ding, Tiangong Lu(A36497), Lipofectamine™ CRISPRMAX™ Cas9 (CMAX00001), TrueGuide™ Synthetic sgRNA sequences of STAT3 (A35533, CATTCGACTCTTGCAGGAAG) were designed and purchased from Invitrogen™, ThermoFisher Scientific (Carlsbad,

(4) PTEN deficiency confers sensitivity to ATR inhibitor–based treatment in high-grade serous ovarian cancerJ Clin InvestJuly 7, 2026Jie Hao, Bose Kochupurakkal, Timothy B. Branigan, Ozge Sezin Somuncu, Renyan Liu, Heta Jadhav, Alexandre André B. A. da Costa, Yuqing Jiao, Jenny Z. Yu, David B. Martignetti, et al.using the CRISPR/Cas9 system. Cells were transfected with sgRNA (Thermo Fisher Scientific, catalog A35533) and Cas9 (Thermo Fisher Scientific, catalog A36497) using Lipofectamine CRISPRMAX Cas9 Transfection Reagent

(5) Cytokine-induced PD-L1 and PD-L2 expression is preserved but reverse signalling is altered in rheumatoid arthritis fibroblast-like synoviocytesArthritis Res TherJune 2, 2026Tilia Selldén, Anna-Karin Hultgård Ekwall, Georgios Chatziagorou, Anna-Carin Lundell, Anna Rudinmaintained until 70% confluency. Synthetic guide RNA (sgRNA) targeting PD-L1 (CD274, catalogue no. #A35533), PD-L2 (PDCD1LG2, catalogue no. #A35533), or non-target control (catalogue no. #A35526) was mixed with

(6) Trisomy 8 alters chromatin conformations and activates Y chromosome genes in stem cells to drive a pre-leukemic stateOncogeneMay 23, 2026Jie Bai, Kimi Araki, Daisuke Kurotaki, Eerdunduleng, Supannika Sorin, Kei Hiramatsu, Narumi Uno, Ai Hamashima, Mihoko Iimori, Kenta Kikuchi, et al.respectively. Two sgRNA-directed Runx1 (Thermo Fisher Scientific, CRISPR33531_SGM and CRISPR32292_SGM of A35533) were mixed at a 1:1 ratio for transduction, and sgRNA non-targeting (Thermo Fisher Scientific, A35526)

(7) Incidence of B-cell Malignancies in Patients with Lung Cancer Receiving PD-1 Blockade TherapyClin Cancer ResMay 19, 2026Toshifumi Ninomiya, Caiyang Fang, Hirofumi Hamano, Teruya Morinaga, Wenhao Zhou, Toshihiro Koyama, Sakura Miki, Li Zhu, Yusuke Naoi, Daisuke Ennishi, et al.(5′-GTCCGTACTCCGCCAGTATG-3′ targeting Cd40) were used to edit the genomic locus. The gRNA (Thermo Fisher Scientific; cat. #A35533, CRISPR521641_SGM CD40) and Cas9 protein (Thermo Fisher Scientific; cat. #A36497) were transfected into

(8) A CD4+ T cell-fibroblast crosstalk exacerbates autoimmunity in a mouse model of primary Sjögren diseaseNature CommunicationsMay 12, 2026Kunihiro Otsuka, Hiroyuki Kondo, Shin-Ichi Tsukumo, Daisuke Kurotaki, Kei-ichiro Yasunaga, Aya Ushio, Ruka Nagao, Keiko Aota, Yoshiaki Kitamura, Takaaki Tsunematsu, et al.sequence: 5’-AAAUGUGAGAUCAGAGUAAU-3’) or a TrueGuide sgRNA targeting Tnfsf8 (Thermo Fisher Scientific, Cat# A35533; sequence: 5’-AACAAGGCACACCAGTGCGG-3’), using a 4D-Nucleofector system (Lonza). To assess gene disruption

(9) Targeting STAT5A via CRISPR/Cas9 restores TKI sensitivity in resistant chronic myeloid leukemia cellsMed OncolApril 25, 2026Besne Çelik, Yağmur Kiraz, Yaren Şahin, Burçin Tezcanlı Kaymazfor the CML cell line (K562): TrueGuide™ Synthetic sgRNA (Assay ID: CRISPR731236_SGM, catalog number: A35533, Thermo Scientific). TrueGuide™ sgRNA Negative Control, non-targeting 1 (catalog number: A35523, Thermo Scientific

(10) CK2 inhibition suppresses glial inflammation in models of neuroinflammation and neurodegenerationNature CommunicationsApril 22, 2026Ioana I. N. Da Silva, Desiree Ramirez, Sarah L. Parylak, Leslie A. Wallace, James K. Tucker, Joel M. Erberich, Rutvi Katariya, Aidan H. McDonald, Iryna S. Gallina, Ariana L. Tucker, et al.(Mirus Bio 10766-842). For the CK2 knockouts, custom-order TrueGuide synthetic gRNAs by Thermo-Fisher (A35533) were used: sgCK2Α1 (sequence: GTGAGGATAGCCAAGGTTCT) and sgCK2Α2 (sequence: ACGCCGAGGTGAACAGTCTG). For

(11) Accelerated discovery of cell migration regulators using label-free deep learning-based automated trackingSci AdvMarch 13, 2026Tiffany Chu, Yeongseo Lim, Yufei Sun, Fan Wu, Carolina Castillo, Eban Hanna, Denis Wirtz, Pei-Hsun WuCTTN (CRISPR925694_SGM) True Guide sgRNA (single guide RNA; 480 ng per well, Thermo Fisher Scientific, A35533) using Lipofectamine CRISPRMAX (Thermo Fisher Scientific, CMAX00003) for 48 hours. Following transfection,

(12) HIF sustain a transcriptional regulatory circuit of EPAS1 expression in renal clear cell carcinomaNature CommunicationsFebruary 19, 2026Stephanie Naas, René Krüger, Steffen Grampp, Victoria Lauer, Andre Kraus, Julia Naas, Fabian Müller, Franziska Gsottberger, Mario Schiffer, Bernd Wullich, et al.transfecting TrueCut Cas9 Protein (Thermo Fisher Scientific, Waltham, MA, USA) together with targeting sgRNAs (A35533, Trueguide Synthetic sgRNA, Thermo Fisher Scientific, Waltham, MA, USA) or non-targeting control sgRNAs

(13) Prominin-1 Regulates Retinal Pigment Epithelium Homeostasis: Transcriptomic Insights into Degenerative MechanismsInternational Journal of Molecular SciencesNovember 28, 2025Weihong Huo, Jinggang Yin, Purnima Ghose, Jenny C. Schafer, Edward Chaum, Sujoy Bhattacharyasynthetic guide RNA (gRNA) sequence (5′-CGTTGCTGCAACAAATGCGG-3′) (ThermoFisher Scientific, catalog # A35533) using Lipofectamine CRISPRMAX transfection reagent (ThermoFisher, Cat # CMAX00008) to target the mouse

(14) Chemical compensation to mechanical loss in cell mechanosensationProceedings of the National Academy of SciencesNovember 11, 2025Qin Ni, Zhuoxu Ge, Anindya Sen, Yufei Wu, Jinyu Fu, Alice Amitrano, Nitish Srivastava, Konstantinos Konstantopoulos, Sean X. Sun5′-AGCATTGAAGCGTAACAGGG-PAM-3′ at Chr.8: 122513787 to 122513809 on GRCm38 was purchased from Invitrogen (A35533). The cells were transfected with the Cas9 enzyme (TrueCut Cas9 Protein v2, Thermo Fisher) and the sgRNA

(15) Secondary Necrosis Following Caspase‐Activation can Occur Independently of Gasdermin EAdvanced ScienceNovember 4, 2025Shubhangi Gavali, Francesca Maremonti, Wulf Tonnus, Florian Gembardt, Marlena Nastassja Schlecht, Karolin Flade, Anne von Mässenhausen, Stephen W. G. Tait, Stefan R. Bornstein, Andreas LinkermannLipofectamine CRISPRMAX Cas9 Transfection Reagent,Thermo Fisher Scientific,CMAX00001 "TrueGuide Synthetic sgRNA, DFNA5",Thermo Fisher Scientific,A35533 "TrueGuide Synthetic sgRNA, Negative control",Thermo Fisher Scientific,A35526 Reagents or resources

(16) Multi-epitope immunocapture of huntingtin reveals striatum-selective molecular signaturesMolecular Systems BiologyApril 1, 2025Joshua L Justice, Todd M Greco, Josiah E Hutton, Tavis J Reed, Megan L Mair, Juan Botas, Ileana M Cristea0.89 × 105 cells/ml. Three total HTT sequence-specific TrueGuide single-guide RNA (sgRNA) (Invitrogen #A35533) targeting Exon 1: 5’-TTGTCAGACAATGATTCACA-3’; Exon 2: 5’-GAAGGACTTGAGGGACTCGA-3’; and Exon 3: 5’-CCCAGAAGTTTCTGAAATTC-3;

(17) Proteogenomic analysis reveals adaptive strategies for alleviating the consequences of aneuploidy in cancerThe EMBO JournalFebruary 10, 2025Jan-Eric Bökenkamp, Kristina Keuper, Stefan Redel, Karen Barthel, Leah Johnson, Amelie Becker, Angela Wieland, Markus Räschle, Zuzana StorchováControl siRNA-A,Santa Cruz,sc-37007 53BP1 siRNA (h),Santa Cruz,sc-37455 CRISPR739962_SGM,Thermo Fisher Scientific,A35533 CRISPR739967_SGM,Thermo Fisher Scientific,A35533 "Chemicals, enzymes, and other reagents","Chemicals,

(18) XAF1 is secreted from stressed tumor cells to activate T cell-mediated tumor surveillance via Lck-ERK signalingNeoplasiaJanuary 1, 2025Jieun Ahn, Seung-Hun Jang, Sungchan Jang, Ji-Hye Yoon, Min-Goo Lee, Sung-Gil ChiFor generation of the 4T1-XAF1−/− subline, 4T1 cells were transfected with SpCas9 protein and sgRNA (A35533, Invitrogen, CA, USA) targeting the exon 2 region (5′‑ GGCAAAGGACTATGAAGCGC‑3′) of the mouse Xaf1 gene

(19) Cytoskeletal activation of NHE1 regulates mechanosensitive cell volume adaptation and proliferationCell ReportsDecember 24, 2024Qin Ni, Zhuoxu Ge, Yizeng Li, Gabriel Shatkin, Jinyu Fu, Anindya Sen, Kaustav Bera, Yuhan Yang, Yichen Wang, Yufei Wu, et al.5′-AGCATTGAAGCGTAACAGGG-PAM-3′ at Chr.8: 122513787–122513809 on GRCm38 was purchased from Invitrogen (A35533). The cells were transfected with the Cas9 enzyme (TrueCut Cas9 Protein v2, Thermo Fisher) and the sgRNA

(20) JUNB O‐GlcNAcylation‐Mediated Promoter Accessibility of Metabolic Genes Modulates Distinct Epithelial Lineage in Pulmonary FibrosisAdvanced ScienceDecember 15, 2024Marie‐Therese Bammert, Meshal Ansari, Leoni Haag, Zuhdi Ahmad, Victoria Schröder, Joseph Birch, Diana Santacruz, Werner Rust, Coralie Viollet, Benjamin Strobel, et al.complex, plasmids, or control, respectively. The following TrueGuide Synthetic gRNAs (Thermo Fisher, #A35533) were used: OGT (CRISPR887744_SGM); JUNB (CRISPR924803_SGM, CRISPR924804_SGM ratio 1:1 mixed); TrueGuide

Be the First to Write a Review!

TrueGuide sgRNA, predeisgned, modified from Thermo Fisher Scientific

Description

Thermo Fisher Scientific

Citations (41)

Reviews

TrueGuide sgRNA, predeisgned, modified from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map