Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Product Specs
ItemAlt-R™ CRISPR Cas9 tracrRNA
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1072532
ApplicationsGene Expression and Molecular Cloning, CRISPR
TypeCRISPR/Cas9 Vectors

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) Multiple adhesion molecules act together in oligodendrocyte-mediated axonal selection and myelin formationPLoS BiolJune 25, 2026Swathi Radha, Martina Arends, Georg Kislinger, Agata Rhomberg, Martina Schifferer, Minou Djannatian, Mikael SimonsThe 20-bp target sequence was synthesized as Alt-R CRISPR-Cas9 crRNA and annealed with the tracrRNA (#1072532) (both from IDT) according to the recommended protocol to obtain the crRNA:tracrRNA complex. For CRISPR-Cas9

(2) A pilot study for whole proteome tagging in Caenorhabditis elegansElifeJune 24, 2026Matthew Eroglu, Oliver Hobertstored at –80 °C until use. tracrRNA was ordered from IDT (Alt-R CRISPR-Cas9 tracrRNA, 20 nmol, Cat: 1072532), resuspended in the provided nuclease-free duplex buffer to 0.4 µg/µl (18 µM), aliquoted, and stored

(3) SIRT2 antagonizes MOF function during mitotic entrySci AdvJune 19, 2026María Espinosa-Alcantud, Núria Sima, Irene Fernández-Duran, Anna Marazuela-Duque, Gerard Martínez-Cebrián, Anna Guitart-Solanes, Andrés Gámez-García, Paloma Martínez-Redondo, Laia Bosch-Presegué, Berta N. Vazquez, et al.Lys175 crRNA, GAUCACCAAGGUGAAGUAUGGUUUUAGAGCUAUGCU) that hybridizes with a universal tracrRNA (IDT, 1072532) to form a functional sgRNA duplex to activate the Cas9 enzyme (IDT, 1081058) and a specific HDR (homology-

(4) Improved Cas9-targeted nanopore sequencing facilitates ultra-deep analysis of genomic variationCell Reports MethodsMay 18, 2026Nick Vereecke, Megan Behrmann, Anupama Khare, John P. Dekker7.5; IDT 11-01-02-02] and stored at −20°C. The same was done for the S. pyogenes Cas9 tracrRNA (IDT 1072532). Next, the ribonucleotide complexes (RNPs) were constructed according to ONT’s instructions, using

(5) Engulfment by brain macrophages in a short-lived vertebratebioRxivMay 5, 2026Rahul Nagvekar, Angela N. Pogson, Prateek R. Kalakuntla, Helena J. Barr, Azalia M. Martínez Jaimes, S.V. Perry, Emma K. Costa, Jingxun Chen, Felix Boos, Paloma Navarro Negredo, et al.sequence in Supplementary Table 2) and 1 μL of tracrRNA (at 100 μM in Nuclease-Free Duplex Buffer; IDT, 1072532/3/4) were added to 31.3 μL Nuclease-Free Duplex Buffer and annealed at 95°C for 5 minutes to generate

(6) Lipid asymmetry disruption by XKR8 orchestrates neutrophil extracellular trap formation and inhibits fungal infectionNature immunologyMay 1, 2026Liu W, Ping J, Deng L, Wang K, Xu J, Peng N, Yang M, Tang H, Liu Z, Wang W, et al.HL-60 cells. Transduced cells were selected using puromycin (1 μg ml−1). In addition, CRISPR–Cas9 tracrRNA (1072532), Cas9-GFP V3 (10008100) and corresponding CRISPR–Cas9 crRNA were purchased from IDT. The Cas9–GFP protein,

(7) A covalent allosteric molecular glue suppresses NRF2-dependent cancer growthCancer DiscoveryMay 1, 2026Nilotpal Roy, Tine Wyseure, I-Chung Lo, Justine Lu, Christie L. Eissler, Steffen M. Bernard, Ilah Bok, Aaron N. Snead, Albert Parker, U-Ging Lo, et al.1.5 μL of crRNA was combined with 100 μmol/L of trans-activating CRISPR RNA (tracrRNA) (IDT, cat. #1072532), heated at 95°C for 5 minutes, and cooled to room temperature. The RNP complex was formed by combining

(8) AFD thermosensory neurons mediate tactile-dependent locomotion modulation in C. elegansElifeApril 27, 2026Manuel Rosero, Jihong Bai12537100, "Commercial assay, kit",Alt-R CRISPR-Cas9 tracrRNA,"Integrated DNA Technologies (IDT, NJ)",Cat# 1072532, "Commercial assay, kit",Alt-R S.p. Cas9 Nuclease V3,"Integrated DNA Technologies (IDT, NJ)",Cat# 1081058, Sequence-based

(9) AFD Thermosensory Neurons Mediate Tactile-Dependent Locomotion Modulation in C. eleganseLifeApril 27, 2026Manuel Rosero, Jihong Bai12537100, "Commercial assay, kit",Alt-R CRISPR-Cas9 tracrRNA,"Integrated DNA Technologies (IDT, NJ)",Cat# 1072532, "Commercial assay, kit",Alt-R S.p. Cas9 Nuclease V3,"Integrated DNA Technologies (IDT, NJ)",Cat# 1081058, Sequence-based

(10) Remote homology and functional genetics unmask deeply preserved Scm3/HJURP orthologs in metazoansbioRxivApril 22, 2026Jeremy A. Hollis, Jason A. Stonick, Irini Topalidou, Janet M. Young, Cecilia B. Moens, Nicolas J. Lehrbach, Melody G. Campbell, Harmit S. Malikgenome editing was performed by microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1072532, #1081058) and custom crRNA along with either ssDNA oligos (IDT) or partially-melted dsDNA oligos as

(11) Molecular and functional dissection using CaMPARI-seq reveals the neuronal organization for dissociating optic flow-dependent behaviorsNat CommunApril 17, 2026Koji Matsuda, Chung-Han Wang, Hisaya Kakinuma, Atsushi Toyoda, Tomoya Shiraki, Koichi Kawakami, Fumi Kuboproduced by annealing custom-synthesized crRNA (Alt-R CRISPR-Cas9 crRNA, IDT) with tracrRNA (IDT, Cat# 1072532) in Nuclease-Free Duplex Buffer (IDT, Cat# 11-05-01-12) and subsequently incubated with Cas9 protein

(12) The G-protein coupled receptor OXER1 is a tissue redox sensor essential for intestinal epithelial barrier integritybioRxivApril 11, 2026Miklos Lengyel, Yanan Ma, Zaza Gelashvili, Siyang Peng, Meysoon Quraishi, Philipp Niethammertarget-specific Alt-R crRNA (Crispr RNA) and common Alt-R tracrRNA (Trans-Activating Crispr RNA, IDT 1072532) were dissolved in nuclease-free duplex buffer (IDT; 11-01-03-01) to obtain a 100 mM stock solution.

(13) A neuropeptide regulates cell non-autonomous protein homeostasisCell ReportsApril 1, 2026Carrie A. Sheeler, Jacqueline Y. Lo, Areebah Rahman, Saebom Kwon, Daviana Menendez Escalera, Emmett Griffin-Baldwin, Karmen Mah, Adam Roszczyk, Jennifer L. Garrison, Ashley E. Frakes7495.7-32 Trizol,Invitrogen,Cat# 15596026 Chloroform,Fisher Scientific,Cat# C298-500 Alt-R CRISPR-Cas9 tracrRNA,IDT,Cat# 1072532 Alt-R™ S.p. Cas9 Nuclease V3,IDT,Cat# 1081058 Hexane,Sigma,Cat# 139386 ,, Critical commercial assays,Critical

(14) Scalable single-cell total RNA sequencing unifies coding and non-coding transcriptomicsNature BiotechnologyMarch 31, 2026Alina Isakova, Daniel Dan Liu, Ivana Cvijović, Rahul Sinha, Anna E. Eastman, Sirle Saul, Angela M. Detweiler, Norma Neff, Shirit Einav, Irving L. Weissman, et al.ribonucleoprotein complexes were assembled from Alt-R S.p. Cas9 Nuclease V3 (NEB, 1081059), tracrRNA (IDT, 1072532), and a custom pool of 57 crRNAs (IDT) designed based on Smart-seq-total DASH oligos (Supplementary

(15) GPR75 in glutamatergic neurons regulates body weightCell ReportsMarch 24, 2026Steven C. Wyler, Surbhi Gahlot, Lara Bideyan, Kyle Brown, Jennifer K. Schiavo, Marco Galvan, Shreya Thomas, Arely Tinajero, Adan Khan, Warda Merchant, et al.Integrated DNA Technologies (IDT),Alt-R™ CRISPR-Cas9 tracrRNA,Integrated DNA Technologies (IDT),Cat# 1072532 qPCR probes: Table S1,Life Biotechnologies,N/A Genotyping primers: Table S1,Integrated DNA Technologies

(16) MASTR-seq enables multiplexed analysis of short tandem repeats with sequencingCell Rep MethodsMarch 23, 2026Chuanbin Su, Han-Seul Ryu, Keerthivasan Raanin Chandradoss, Thomas Malachowski, Ravi Boya, Linda Zhou, Hoa Emma Nguyen, Esteban O. Mazzoni, Kristen J. Brennand, Jennifer E. Phillips-CreminsFigure S1; Table S1). We synthesized custom lyophilized crRNAs (2 nmol each) and tracrRNA (2 nmol, IDT 1072532), resuspended them to 100 μM in 10 mM Tris-EDTA (pH 7.5), and pooled the crRNAs equally. We prepared

(17) Molecular convergence of risk variants for congenital heart defects leveraging a regulatory map of the human fetal heartmedRxivMarch 3, 2026X. Rosa Ma, Stephanie D. Conley, Michael Kosicki, Danila Bredikhin, Ran Cui, Steven Tran, Maya U. Sheth, Wei-Lin Qiu, Sijie Chen, Soumya Kundu, et al.final concentration 20 ng/μL), hybridized sgRNA against H11 locus (Alt-R CRISPR-Cas9 tracrRNA, IDT, cat#1072532 and Alt-R CRISPR-Cas9 locus targeting crRNA, gctgatggaacaggtaacaa, total final concentration 50 ng/μL)

(18) Protocol to study the role of endogenously produced itaconate using CRISPR-Cas9 technology in THP-1 cellsSTAR ProtocolsMarch 1, 2026Luke A. Bourner, Katie A. Acken, Haiyan Long, Linda A. Chung, Kenneth D. Roth, Frank C. DorseyTechnologies),Cat#1081061 crRNA,IDT,Cat#ACOD1.1AC Nuclease-Free IDTE,IDT,Cat#11-01-02-02 tracrRNA,IDT,Cat#1072532 Electroporation Enhancer,IDT,Cat#1075916 10X Tris/Glycine/SDS running buffer,Bio-Rad,Cat#161-0732 1X

(19) ROME, an ancient gene with a novel function in vertebrates, is a key modulator of embryonal development and cancer metastasisCancer Research CommunicationsMarch 1, 2026Anna Molotkova, Emre Deniz, Matthew Swift, Eric Glasgow, Junfeng Ma, Jeffrey A. Petro, Isabel Frye, Metin Ozdemirli, Dusan Pesic, Gerard P. Ahern, et al.Technologies (IDT): 5′-TAAGACGTATGCTTTCACCGTGG-3′ (PAM not included in oligo). The crRNA and tracrRNA (1072532; IDT) were resuspended in duplex buffer (IDT) at 100 mmol/L and annealed by mixing 1:1 to make a 50

(20) ROME, an Ancient Gene with a Novel Function in Vertebrates, Is a Key Modulator of Embryonal Development and Cancer MetastasisCancer Res CommunMarch 1, 2026Anna Molotkova, Emre Deniz, Matthew Swift, Eric Glasgow, Junfeng Ma, Jeffrey A. Petro, Isabel Frye, Metin Ozdemirli, Dusan Pesic, Gerard P. Ahern, et al.Technologies (IDT): 5′-TAAGACGTATGCTTTCACCGTGG-3′ (PAM not included in oligo). The crRNA and tracrRNA (1072532; IDT) were resuspended in duplex buffer (IDT) at 100 mmol/L and annealed by mixing 1:1 to make a 50

Be the First to Write a Review!

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (346)

Reviews

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map