Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Product Specs
ItemAlt-R™ CRISPR Cas9 tracrRNA
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1072532
ApplicationsGene Expression and Molecular Cloning, CRISPR
TypeCRISPR/Cas9 Vectors

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) Adenosine signaling promotes double-negative T-cell anticancer responses in conditions of CD8 T-cell lymphopeniaBlood Immunology & Cellular TherapyJuly 29, 2026Zhi Huang, Brionna King, Laura Naldi, Lucio Miele, Giulia Monticone(tracrRNA) in a 1:1 ratio and annealed at 95° C for 5 minutes; 300 pmol crRNA:tracrRNA (IDT; catalog no. 1072532) duplex were combined with 100 pmol Cas9 (IDT; catalog no. 1081058) and incubated at room temperature

(2) Microbial induction of MHC-II expression in colon cancer cells overcomes immunotherapy resistance and limits metastasisbioRxivJuly 4, 2026Charlie Chung, Elif Ozcelik, Jialing Zhang, Zeli Shen, Onur Eskiocak, Yihan Qin, Jill Habel, Kadir Ozler, Santhilal Subhash, Zakaria Aminzada, et al.Polybrene Infection / Transfection Reagent,Sigma-Aldrich,Cat# TR-1003 Puromycin,Gibco,Cat# A1113803 OPTI-MEM,Gibco,Cat# 31985062 Alt-R CRISPR-Cas9,IDT,Cat# 1072532 HEPES (1M),Thermo Fisher Scientific,Cat# 15630080 Sodium Pyruvate (100mM),Thermo Fisher Scientific,Cat#

(3) Remote homology and functional genetics unmask deeply preserved Scm3/HJURP orthologs in metazoansSci AdvJuly 3, 2026Jeremy A. Hollis, Jason A. Stonick, Irini Topalidou, Janet M. Young, Cecilia B. Moens, Nicolas J. Lehrbach, Melody G. Campbell, Harmit S. Malikgenome editing was performed by microinjection of guide RNA/Cas9 ribonucleoprotein complexes (IDT #1072532, #1081058) and custom crRNA along with either single-stranded DNA oligos (IDT) or partially melted double-stranded

(4) Cell-type-specific architecture of the hypothalamus in a socially plastic vertebratebioRxivJune 30, 2026Melanie Dussenne, Micah Castillo, Preethi H. Gunaratne, Andrew P. Hoadley, Lauren A. Saenz, Beau A. Alwardpredicted essential domains and were synthesized by IDT (Fig. S26). tracrRNA was synthesized by IDT (1072532). The crRNA:tracrRNA duplex (final conc. 5 μM) was delivered along with Cas9 protein (IDT, final conc.

(5) Multiple adhesion molecules act together in oligodendrocyte-mediated axonal selection and myelin formationPLoS BiolJune 25, 2026Swathi Radha, Martina Arends, Georg Kislinger, Agata Rhomberg, Martina Schifferer, Minou Djannatian, Mikael SimonsThe 20-bp target sequence was synthesized as Alt-R CRISPR-Cas9 crRNA and annealed with the tracrRNA (#1072532) (both from IDT) according to the recommended protocol to obtain the crRNA:tracrRNA complex. For CRISPR-Cas9

(6) A pilot study for whole proteome tagging in Caenorhabditis elegansElifeJune 24, 2026Matthew Eroglu, Oliver Hobertstored at –80 °C until use. tracrRNA was ordered from IDT (Alt-R CRISPR-Cas9 tracrRNA, 20 nmol, Cat: 1072532), resuspended in the provided nuclease-free duplex buffer to 0.4 µg/µl (18 µM), aliquoted, and stored

(7) Single-molecule imaging reveals RNA polymerase II dynamics and TAF1-dependent promoter-proximal pause releaseNature CommunicationsJune 20, 2026Nayem Haque, Ronald Cutler, Simone Sidoli, Robert A. Colemancm tissue culture dishes. Guide RNAs (gRNAs) were prepared by mixing 3.6 μL of 200 μM tracrRNA (IDT, 1072532) with 3.6 μL of 200 μM gene-specific crRNA (Supplementary Table 3) in nuclease-free duplex buffer (IDT,

(8) SIRT2 antagonizes MOF function during mitotic entrySci AdvJune 19, 2026María Espinosa-Alcantud, Núria Sima, Irene Fernández-Duran, Anna Marazuela-Duque, Gerard Martínez-Cebrián, Anna Guitart-Solanes, Andrés Gámez-García, Paloma Martínez-Redondo, Laia Bosch-Presegué, Berta N. Vazquez, et al.Lys175 crRNA, GAUCACCAAGGUGAAGUAUGGUUUUAGAGCUAUGCU) that hybridizes with a universal tracrRNA (IDT, 1072532) to form a functional sgRNA duplex to activate the Cas9 enzyme (IDT, 1081058) and a specific HDR (homology-

(9) Non-coding structural variants disrupt FOXG1 transcriptional regulation in early neurodevelopmentNature CommunicationsJune 3, 2026Lisa Hamerlinck, Eva D’haene, Michael B. Vaughan, Nore Van Loon, María del Rocío Pérez Baca, Sebastian Leimbacher, Michael Kosicki, Lara Colombo, Lukas Genbrugge, Lies Vantomme, et al.final concentration 20 ng/μL), hybridized sgRNA against H11 locus (Alt-R CRISPR-Cas9 tracrRNA, IDT, cat#1072532 and Alt-R CRISPR-Cas9 locus targeting crRNA, gctgatggaacaggtaacaa, total final concentration 50 ng/μL),

(10) Improved Cas9-targeted nanopore sequencing facilitates ultra-deep analysis of genomic variationCell Reports MethodsMay 18, 2026Nick Vereecke, Megan Behrmann, Anupama Khare, John P. Dekker7.5; IDT 11-01-02-02] and stored at −20°C. The same was done for the S. pyogenes Cas9 tracrRNA (IDT 1072532). Next, the ribonucleotide complexes (RNPs) were constructed according to ONT’s instructions, using

(11) Engulfment by brain macrophages in a short-lived vertebratebioRxivMay 5, 2026Rahul Nagvekar, Angela N. Pogson, Prateek R. Kalakuntla, Helena J. Barr, Azalia M. Martínez Jaimes, S.V. Perry, Emma K. Costa, Jingxun Chen, Felix Boos, Paloma Navarro Negredo, et al.sequence in Supplementary Table 2) and 1 μL of tracrRNA (at 100 μM in Nuclease-Free Duplex Buffer; IDT, 1072532/3/4) were added to 31.3 μL Nuclease-Free Duplex Buffer and annealed at 95°C for 5 minutes to generate

(12) Lipid asymmetry disruption by XKR8 orchestrates neutrophil extracellular trap formation and inhibits fungal infectionNature immunologyMay 1, 2026Liu W, Ping J, Deng L, Wang K, Xu J, Peng N, Yang M, Tang H, Liu Z, Wang W, et al.HL-60 cells. Transduced cells were selected using puromycin (1 μg ml−1). In addition, CRISPR–Cas9 tracrRNA (1072532), Cas9-GFP V3 (10008100) and corresponding CRISPR–Cas9 crRNA were purchased from IDT. The Cas9–GFP protein,

(13) A covalent allosteric molecular glue suppresses NRF2-dependent cancer growthCancer DiscoveryMay 1, 2026Nilotpal Roy, Tine Wyseure, I-Chung Lo, Justine Lu, Christie L. Eissler, Steffen M. Bernard, Ilah Bok, Aaron N. Snead, Albert Parker, U-Ging Lo, et al.1.5 μL of crRNA was combined with 100 μmol/L of trans-activating CRISPR RNA (tracrRNA) (IDT, cat. #1072532), heated at 95°C for 5 minutes, and cooled to room temperature. The RNP complex was formed by combining

(14) SIRT7 links H3K36ac epigenetic regulation with genome maintenance in the mouse testisNature CommunicationsApril 28, 2026Anna Guitart-Solanes, Mayra Romero, Andres Gamez-Garcia, Irene Fernández-Duran, Bryan A. Niedenberger, Cristina Madrid-Sandín, Norah Spears, Ignasi Roig, Christopher B. Geyer, Alejandro Vaquero, et al.crRNAs were designed using the IDT Alt-R CRISPR design tool (Supplementary Table 1). TracrRNA (IDT, 1072532), crRNAs and Cas9 nuclease (IDT, 1081058) were nucleofected into spermatocyte-derived GC-2spd(ts) cells

(15) AFD thermosensory neurons mediate tactile-dependent locomotion modulation in C. elegansElifeApril 27, 2026Manuel Rosero, Jihong Bai12537100, "Commercial assay, kit",Alt-R CRISPR-Cas9 tracrRNA,"Integrated DNA Technologies (IDT, NJ)",Cat# 1072532, "Commercial assay, kit",Alt-R S.p. Cas9 Nuclease V3,"Integrated DNA Technologies (IDT, NJ)",Cat# 1081058, Sequence-based

(16) AFD Thermosensory Neurons Mediate Tactile-Dependent Locomotion Modulation in C. eleganseLifeApril 27, 2026Manuel Rosero, Jihong Bai12537100, "Commercial assay, kit",Alt-R CRISPR-Cas9 tracrRNA,"Integrated DNA Technologies (IDT, NJ)",Cat# 1072532, "Commercial assay, kit",Alt-R S.p. Cas9 Nuclease V3,"Integrated DNA Technologies (IDT, NJ)",Cat# 1081058, Sequence-based

(17) Remote homology and functional genetics unmask deeply preserved Scm3/HJURP orthologs in metazoansbioRxivApril 22, 2026Jeremy A. Hollis, Jason A. Stonick, Irini Topalidou, Janet M. Young, Cecilia B. Moens, Nicolas J. Lehrbach, Melody G. Campbell, Harmit S. Malikgenome editing was performed by microinjection of guide RNA/Cas9 ribonucleoprotein (RNP) complexes (IDT #1072532, #1081058) and custom crRNA along with either ssDNA oligos (IDT) or partially-melted dsDNA oligos as

(18) Molecular and functional dissection using CaMPARI-seq reveals the neuronal organization for dissociating optic flow-dependent behaviorsNat CommunApril 17, 2026Koji Matsuda, Chung-Han Wang, Hisaya Kakinuma, Atsushi Toyoda, Tomoya Shiraki, Koichi Kawakami, Fumi Kuboproduced by annealing custom-synthesized crRNA (Alt-R CRISPR-Cas9 crRNA, IDT) with tracrRNA (IDT, Cat# 1072532) in Nuclease-Free Duplex Buffer (IDT, Cat# 11-05-01-12) and subsequently incubated with Cas9 protein

(19) The G-protein coupled receptor OXER1 is a tissue redox sensor essential for intestinal epithelial barrier integritybioRxivApril 11, 2026Miklos Lengyel, Yanan Ma, Zaza Gelashvili, Siyang Peng, Meysoon Quraishi, Philipp Niethammertarget-specific Alt-R crRNA (Crispr RNA) and common Alt-R tracrRNA (Trans-Activating Crispr RNA, IDT 1072532) were dissolved in nuclease-free duplex buffer (IDT; 11-01-03-01) to obtain a 100 mM stock solution.

(20) Microhomology-mediated end joining acts directly on replication forks to repair single-ended double-strand breaksMolecular CellApril 2, 2026Shibo Li, Yuqin Zhao, Youhang Li, Sameer Bikram Shah, Yanmeng Shi, Tran Nguyen, Zi Wang, Chia-Yu Chang, Anagh Ray, Te-Hsuan Bu, et al.by Bio-Synthesis Inc. 200 pmol caged gRNA was mixed with 200 pmol Alt-R™ CRISPR-Cas9 tracrRNA (IDT, 1072532), heated to 95°C for 5 minutes, and allowed to cool to room temperature for 5 minutes. 3 μl of 10 μg/μl

Be the First to Write a Review!

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (355)

Reviews

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map