Alt-R™CRISPR Cas9 tracrRNA, ATTO™ 550 from Integrated DNA Technologies

Product Specs
ItemAlt-R™CRISPR Cas9 tracrRNA, ATTO™ 550
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1075927
ApplicationsGene Expression and Molecular Cloning, CRISPR
TypeCRISPR/Cas9 Vectors
Conjugate/Tag/LabelATTO™ 550

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) A standardized approach to test missense PNPLA1 rare genetic variants of uncertain significance in epidermal differentiation disordersJID InnovationsMarch 1, 2026Nuria Pell, Pauline Bernard, Séverine Courrech, Lukas Opalka, Aina Millán-Sánchez, Elise Levy, Séverine Garnier, Cyrielle Clément, Pauline Le Faouder, Katerina Vávrová, et al.targeting a specific region of PNPLA1 sequence and a trans-activating CRISPR RNA-ATTO 550 (200 mM, number 1075927, Integrated DNA Technologies). We designed 4 different CRISPR RNA sequences using the software tool

(2) The SETD2 L1609P mutation found in leukemia disrupts methyltransferase activity and reduces histone H3K36 trimethylationJournal of Biological ChemistryFebruary 5, 2026Christina Michail, Jérémy Berthelet, Ariel E. Mechaly, Linh-Chi Bui, Haopeng Yang, Duo Cai, Amira Al Mahi, Aowei Xie, Valeria Bisio, Valentina Sirri, et al.ribonucleoprotein (RNP). Specifically, crRNA (IDT) targeting SETD2 was annealed with Atto550-labeled tracrRNA (1075927, IDT) and subsequently formed RNP with Alt-R S.p. Cas9 Nuclease V3 (1081058, IDT) prior to electroporation.

(3) Targeting PLK1 Reduces MMP10 to Enhance Radiosensitivity in HPV— Head and Neck CancerClinical Cancer ResearchJanuary 16, 2026Julianna Korns, Maria A. Lehn, Shreya Shyamsunder, Mario Medvedovic, Stephanie M. Bryant, Mathieu G. Sertorio, Maya Ridinger, Trisha M. Wise-Draper, Vinita TakiarCrispr-Cas9 Knockout Guide RNAs (gRNA) for MMP10 were combined with a Trac-ATTO 550 RNA (IDT, Cat# 1075927) and incubated at 95°C for 5 minutes. Cas9 (IDT, Cat# 1081058), Cas9 PLUS (ThermoFisher, Cat# CMAX00003),

(4) Molecular basis of XPF-ERCC1 targeting to SLX4-dependent DNA repair pathwaysNature CommunicationsDecember 16, 2025Junjie Feng, Peter R. Martin, Szymon Kowalski, Maxime Lecot, Nora B. Cronin, Teige Matthews-Palmer, Wojciech Niedzwiedz, Basil J. GreberTechnologies, cat. no. 10008100), Alt-R CRISPR-Cas9 tracrRNA, ATTO™ 550 (Integrated DNA Technologies, cat. no. 1075927) and Alt-R CRISPR-Cas9 crRNA targeting exon 1 of the CIP2A locus (ERCC4 crRNA: TGTCGCTCGTACTCCAGCAG)

(5) A phenotypic brain organoid atlas and biobank for neurodevelopmental disordersCell Stem CellDecember 4, 2025Lu Wang, Yuji Nakamura, Junhao Li, David Sievert, Yang Liu, Toan Nguyen, Prudhvi Sai Jetti, Ethan Thai, Rachel Yibei Zhou, Jiaming Weng, et al.,Integrated DNA Technologies,Cat#1081060 "Alt-R™CRISPR-Cas9 tracrRNA, ATTO™ 550",Integrated DNA Technologies,Cat#1075927 Alt-R™ HDR Enhancer V2,Integrated DNA Technologies,Cat#10007921 Corning®Matrigel® Basement Membrane

(6) Distinct roles of Atf3 , Zfp711 and Bcl6b in early embryonic hematopoietic and endothelial lineage specificationDevelopmentDecember 1, 2025Ridvan Cetin, Giulia Picco, Jente van Staalduinen, Eric Bindels, Remco Hoogenboezem, Gregory van Beek, Mathijs A. Sanders, Yaren Fidan, Ahmet Korkmaz, Joost Gribnau, et al.guidelines of IDT [version 6 (v6)] followed downstream analysis with Alt-R CRISPR-Cas9 tracrRNA. ATTO 550 (1075927), Alt-R CRISPR-Cas9 crRNA, Alt-R S.p. Cas9 Nuclease V3, (1081058) and 1075927 Lipofectamine CRISPRMAX

(7) Towards antibody-based immunotherapy development for platinum-resistant high-grade serous ovarian cancerScientific ReportsNovember 28, 2025Zivile Giedraityte, Noora Aarnio, Faez Amokrane Nait Mohamed\setlength{\oddsidemargin}{-69pt} \begin{document}$$^\textrm{TM}$$\end{document} 550 modified tracrRNA (catalog number: 1075927) was purchased from Integrated DNA Technologies (USA) for enrichment of transfected cells. Single clones

(8) The CIP2A-TOPBP1 axis facilitates mitotic DNA repair via MiDAS and MMEJNature CommunicationsNovember 27, 2025Peter R. Martin, Jadwiga Nieminuszczy, Zuza Kozik, Nihal Jakub, Szymon Kowalski, Maxime Lecot, Julia Vorhauser, Karen A. Lane, Alexandra Kanellou, Jörg Mansfeld, et al.ribonucleoprotein delivery. Alt-R™ S.p. Cas9-GFP V3 (IDT, 10008100), Alt-R™ CRISPR-Cas9 tracrRNA, ATTO™ 550 (IDT, 1075927) and Alt-R™ CRISPR-Cas9 crRNA targeting exon 1 of the CIP2A locus (CIP2A crRNA: GGAGTCCATTGCACCGGCCGCGG)

(9) Atypical contribution of caspase-3 to melanoma cancer cell motility by regulation of coronin 1B activityCell Death DisOctober 6, 2025Kevin Berthenet, Serena Diazzi, Catherine Jamard, Kinga B. Stopa, Clara Gil, Stefan Dragan, Deborah Fanfone, Trang TM. Nguyen, Nathalie Al, Francois Virard, et al.in Table S1. The CASP3-targeting CRISPR-Cas9 crRNA was duplexed with the CRISPR-Cas9 tracrRNA (IDT, 1075927) by heating at 95 °C for 5 min. This duplex was then complexed with recombinant Cas9 protein (Biotechne,

(10) G-protein-coupled receptor ADGRG1 drives a protective microglial state in Alzheimer's disease through MYC activationNeuronOctober 1, 2025Beika Zhu, Andi Wangzhou, Diankun Yu, Tao Li, Rachael Schmidt, Stacy L. De Florencio, Lauren Chao, Alicia L. Thurber, Minqi Zhou, Zeina Msheik, et al.targeting exon 7 of the ADGRG1 gene locus. Equal amount of crRNA and ATTO™550- labeled tracrRNA (IDT, 1075927) were mixed to a final concentration of 100 μM, heated to 95 °C for 5 minutes, and then cooled to room

(11) Microglia regulate GABAergic neurogenesis in prenatal human brain through IGF1NatureAugust 6, 2025Diankun Yu, Samhita Jain, Andi Wangzhou, Beika Zhu, Wenyuan Shao, Elena J. Coley-O’Rourke, Stacy De Florencio, JaeYeon Kim, Jennifer Ja-Yoon Choi, Mercedes F. Paredes, et al.Alt-R CRISPR–Cas9 guide RNA (IDT). Equal amounts of CRISPR RNA and ATTO 550 labelled tracrRNA (IDT; 1075927) were mixed to a final concentration of 100 μΜ, heated to 95 °C for 5 min and then cooled to room temperature

(12) Classically activated macrophages undergo functionally significant nucleotide metabolism remodelling driven by nitric oxideNature MetabolismAugust 4, 2025Steven V. John, Gretchen L. Seim, Billy J. Erazo-Flores, James A. Votava, Uzziah S. Urquiza, Nicholas L. Arp, John Steill, Jack Freeman, Lauren N. Carnevale, Isaiah Roberts, et al.of Alt-R S.p. HiFi Cas9 Nuclease V3 (IDT: 1081060), Alt-R CRISPR–Cas9 gRNA (IDT), and ATTO 550 (IDT: 1075927). The following gRNA sequences were used: HPRT: ACGGGGGACATAAAAGTTAT Nos2−/− RAW 264.7 cells that were

(13) Lestaurtinib's antineoplastic activity converges on JAK/STAT signaling to inhibit treatment naïve and therapy resistant forms ovarian cancerNPJ Precis OncolJuly 11, 2025Esther P. B. Rodman, Michael J. Emch, Xiaonan Hou, Archit Bajaj, Nicole A. Pearson, August J. John, Yamillie Ortiz, Adam D. Bass, Saloni Singh, Gustavo Baldassarre, et al.high-confidence guide RNAs88. Guide RNAs, along with Alt-R CRISPR-Cas9-tracrRNA 5’ATTO550 (tracrRNA, #1075927) and Alt-R Cas9 protein (#1081058), were purchased from IDT. Cells were plated in 10 cm dishes at approximately

(14) The Sotos syndrome gene Nsd1 safeguards developmental gene enhancers poised for transcription by maintaining the precise deposition of histone methylationJournal of Biological ChemistryMarch 19, 2025Jie Li, Zhucui Li, Jiekai Yin, Yinsheng Wang, Deyou Zheng, Ling Cai, Gang Greg Wanguniversal tracrRNA (transactivating crRNA) labeled with the ATTO 500 fluorescent dye at its 5′end (IDT cat# 1075927) were synthesized as RNA oligos and then annealed to form duplex, followed by incubation with the Cas9

(15) The pseudorabies virus UL13 protein kinase triggers phosphorylation of the RNA demethylase FTO, which is associated with FTO-dependent suppression of interferon-stimulated gene expressionJournal of VirologyFebruary 25, 2025Ruth Verhamme, Robert J. J. Jansens, Jianheng Liu, Fien Van Raemdonck, Cliff Van Waesberghe, Luke Nicholson, Samie R. Jaffrey, Herman W. Favoreelfrom IDT (design ID: CD.Cas9.FWJR4400.BS). The custom crRNA and the trans-activating RNA (tracrRNA) (1075927, IDT) were annealed by heating to 95°C for 5 minutes. The CRISPR-Cas9 RNP was formed by mixing the annealed

(16) A Phenotypic High-Throughput Screen Identifies Small Molecule Modulators of Endogenous RGS10 in BV-2 CellsJournal of Medicinal ChemistryNovember 28, 2024Shwetal Talele, Stephanie Gonzalez, Julia Trudeau, Ahmad Junaid, Cody A Loy, Ryan A. Altman, Benita Sjögrenpurchased from Integrated DNA Technologies (IDT; San Diego, CA). Alt-R CRISPR-Cas9 tracrRNA–ATTO 550 (no. 1075927) and Alt-R S.p. Cas9 Nuclease V3 (#1081058) were purchased from IDT. Design for HiBiT donor template

(17) Glycogen myophosphorylase loss causes increased dependence on glucose in iPSC-derived retinal pigment epitheliumThe Journal of biological chemistryAugust 1, 2024Basu B, Karwatka M, China B, McKibbin M, Khan K, Inglehearn CF, Ladbury JE, Johnson CA.guide sequence and the fluorescently-labeled ATTO-550 tracrRNA (Integrated DNA Technologies (IDT), 1075927) were incubated as per manufacturer’s instructions to obtain a functional guide RNA duplex. The Cas9-GFP

(18) G-quadruplexes are a source of vulnerability in BRCA2 deficient granule cell progenitors and medulloblastomabioRxivJuly 25, 2024Danielle L. Keahi, Mathijs A. Sanders, Matthew R. Paul, Andrew L. H. Webster, Yin Fang, Tom F. Wiley, Samer Shalaby, Thomas S. Carroll, Settara C. Chandrasekharappa, Carolina Sandoval-Garcia, et al.“sgPif1-H”). gRNAs were complexed in oligo duplex buffer (IDT) with a tdTomato-labeled tracrRNA (IDT #1075927) prior to complexing with SpCas9 V3 (IDT #1081059). CRISPR-RNP complexes were delivered to primary medulloblastoma

(19) A PRMT5-ZNF326 axis mediates innate immune activation upon replication stressScience AdvancesJune 7, 2024Phuong Mai Hoang, Denis Torre, Patrick Jaynes, Jessica Ho, Kevin Mohammed, Erik Alvstad, Wan Yee Lam, Vartika Khanchandani, Jie Min Lee, Chin Min Clarissa Toh, et al.Donor oligos and gRNA sequences are listed in table S3. The CRISPR RNA was mixed with tracrRNA (IDT, #1075927) to make gRNA complex at 50 μM final concentration. The gRNA complex was combined with Cas9 nuclease

(20) CHMP2A regulates broad immune cell-mediated antitumor activity in an immunocompetent in vivo head and neck squamous cell carcinoma modelJournal for ImmunoTherapy of CancerMay 3, 2024Jiyoung Yun, Robert Saddawi-Konefka, Benjamin Goldenson, Riyam Al-Msari, Davide Bernareggi, Jaya L Thangaraj, Shiqi Tang, Sonam H Patel, Sarah M Luna, J Silvio Gutkind, et al.200 µM. Designed crRNAs were synthesized with nonspecific Alt-R CRISPR-Cas9 tracrRNA ATTO 550 (IDT #1075927) into gRNAs. 8×105 4MOSC1 and 4MOSC2 cells were each nucleofected using the Amaxa 2D nucleofector (Lonza)

Write a Review

(1)

3/15/2023Good for Selecting Cas9-RNP Targeted Cell YONG MtracrRNA, ATTO™ 550 was used to form gRNA and RNP complex with Cas9 protein. After 24 hours of transfection. RNP-targeted cells were sorted by FACS to separate successfully transfected fluorescent ... Read Review

Alt-R™CRISPR Cas9 tracrRNA, ATTO™ 550 from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (61)

Reviews

Alt-R™CRISPR Cas9 tracrRNA, ATTO™ 550 from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map