TrueGuide sgRNA Negative Control, non-targeting 1 from Thermo Fisher Scientific

Product Specs
ItemTrueGuide sgRNA Negative Control, non-targeting 1
CompanyThermo Fisher Scientific
Price $295.00Supplier Page View Company Product Page
Catalog NumberA35526
Quantity3 nmol
Research AreaCell Analysis, Drug Screening, CRISPR Knockout Kits, Libraries, Gene Editing Services, High Throughput Screening,Expression Analysis, CRISPR Products, Molecular Biology Applications
RNA TypeCRISPR Negative Controls
Vector Type (Standardized)Synthetic
Regulatory StatusFor Research Use Only. Not for use in diagnostic procedures
TypesgRNA

Add to Compare List

Thermo Fisher Scientific

168 Third Avenue

Waltham, MA 02451

United States

Phone: 800-678-5599

Company Profile

Website: www.thermofisher.com

(1) Functional annotation of insulin-responsive genes in human adipocytes reveals PLCXD1 as a lipid storage regulatorNat CommunSeptember 3, 2026Scott Frendo-Cumbo, Danae Zareifi, Joëlle Bigay, Ana Rita Dias Araújo, Alina Lapp, Mattias Hansen, Teresa P. Reindl, Beatrice Engelmann, Felix Klingelhuber, Lina Cordeddu, et al.from Thermo Fisher Scientific along with a non-targeting control sgRNA (TrueGuide Negative Control 1, #A35526, Thermo Fisher Scientific). Genomic DNA was collected post-transfection, and knockout efficiency was

(2) Linear ubiquitin chain assembly complex contributes to NLRP3-mediated pyroptotic cell deathiScienceJuly 17, 2026Tiphaine Douanne, Rosalie Moreau, Valeria Trapani, Kilian Trillet, Hubert B. Leloup, Virginie Petrilli, Julie Gavard, Nicolas Bidèrein29,N/A ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, sgRNA non targeting Ctrl,ThermoFisher,#A35526 sgRNA HOIP 5′-GCGATTATATGGCTACACAG-3′,ThermoFisher,CRISPR1033078_SGM sgRNA HOIL-1 5′-GAGACGCCACTGTCATATCA-3′,ThermoFisher,CRISPR752922_SGM sgRNA

(3) Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosisEMBO ReportsJuly 15, 2026Yanis M Macé, Tiphaine Douanne, Jane Jardine, Kilian Trillet, Rosalie Moreau, Joanna Re, Cara J Ellison, Nadine Laguette, Paul R Elliott, Julie Gavard, et al.were used: CASP3, ATGTCGATGCAGCAAACCTC; SPATA2, GATCAGCCGGAATCGATAAA. The negative sgRNA sequence (A35526) and TrueGuide Cas9 (A36499) were also used. Cells were electroporated using a specific NeonTM Transfection

(4) Vav2 is a master regulator of repair against bacterial pore-forming toxinsLife Sci AllianceJuly 9, 2026Victor Gbenga Kayejo, Ashlee Hensley, Tejal Katore, Peter A Keyelplates. After 24 h, these cells were transfected with either negative control guide RNA (Fisher catalog A35526), or guide RNA targeting Vav2 (Fisher catalog CRISPR957573_SGM, targeting CGCACATCGAAGAGGTCAAA

(5) MRC2-mediated collagen internalization is reduced in fibrotic lung fibroblasts and increased upon phenotypic dedifferentiationJCI InsightJuly 8, 2026Natalie M. Walker, Sean M. Fortier, Jennifer Speth, Steven K. Huang, Sergey Gutor, Timothy S. Blackwell, Marc Peters-Golden5′-GGGCCTCGGACACCAAACTC-3′. A non-targeting sequence (5′-AAATGTGAGATCAGAGTAAT-3′) (Thermo Fisher Scientific, A35526) inserted into TLCV2-deleteGFP served as a negative control. Puromycin selection (5 μg/mL) for 48 hours

(6) MYC serine 62 phosphorylation promotes its association with DNA double-strand breaks to facilitate repair and cell survival under genotoxic stressGenes & DevelopmentJuly 1, 2026Gabriel M. Cohn, Colin J. Daniel, Jennifer R. Eng, Alannah S. MacDonald, Jonathan St-Germain, Nadja M. Pieper, Toshita Kannan, Xiao-Xin Sun, Carl Pelz, Ariffin Ali, et al.A36499) and synthetic guide RNA from Invitrogen TrueGuide Synthetic sgRNA (35514) or negative control (A35526) following the manufacturer's instructions. After 8 h incubation, cells were fixed in 4% PFA for 10

(7) Cytokine-induced PD-L1 and PD-L2 expression is preserved but reverse signalling is altered in rheumatoid arthritis fibroblast-like synoviocytesArthritis Res TherJune 2, 2026Tilia Selldén, Anna-Karin Hultgård Ekwall, Georgios Chatziagorou, Anna-Carin Lundell, Anna Rudincatalogue no. #A35533), PD-L2 (PDCD1LG2, catalogue no. #A35533), or non-target control (catalogue no. #A35526) was mixed with Cas9 nuclease and Cas9 Plus™ reagent in Opti-MEM media (Thermo Fisher). CRISPRMAX™ Reagent

(8) Self‐Assembled Skin Equivalents with Monoclonal CRISPR/Cas9‐Modified N/TERT‐1 Keratinocytes: A Cutting‐Edge model for Human Skin and its DiseasesAdvanced Healthcare MaterialsMay 28, 2026Marta Slaufova, Tugay Karakaya, Michela Di Filippo, Thomas Kündig, Hans‐Dietmar Beerannotation (Homo Sapiens hg38/GRCh38). For both KOs, the TrueGuide sgRNA Negative Control, non‐targeting 1 (A35526, Invitrogen) was used as a non‐targeting control. The mixtures were incubated for 20 min at room temperature.

(9) Trisomy 8 alters chromatin conformations and activates Y chromosome genes in stem cells to drive a pre-leukemic stateOncogeneMay 23, 2026Jie Bai, Kimi Araki, Daisuke Kurotaki, Eerdunduleng, Supannika Sorin, Kei Hiramatsu, Narumi Uno, Ai Hamashima, Mihoko Iimori, Kenta Kikuchi, et al.A35533) were mixed at a 1:1 ratio for transduction, and sgRNA non-targeting (Thermo Fisher Scientific, A35526) was used as a negative control. The electroporation of Cas9-sgRNA RNPs was performed as previously

(10) A CD4+ T cell-fibroblast crosstalk exacerbates autoimmunity in a mouse model of primary Sjögren diseaseNature CommunicationsMay 12, 2026Kunihiro Otsuka, Hiroyuki Kondo, Shin-Ichi Tsukumo, Daisuke Kurotaki, Kei-ichiro Yasunaga, Aya Ushio, Ruka Nagao, Keiko Aota, Yoshiaki Kitamura, Takaaki Tsunematsu, et al.Cat# Z2679N) complexed with either a TrueGuide sgRNA negative control (Thermo Fisher Scientific, Cat# A35526; sequence: 5’-AAAUGUGAGAUCAGAGUAAU-3’) or a TrueGuide sgRNA targeting Tnfsf8 (Thermo Fisher Scientific,

(11) Targeting STAT5A via CRISPR/Cas9 restores TKI sensitivity in resistant chronic myeloid leukemia cellsMed OncolApril 25, 2026Besne Çelik, Yağmur Kiraz, Yaren Şahin, Burçin Tezcanlı Kaymazwas used as a negative control and TrueGuide™ sgRNA Positive Control, CDK4 (human) (catalog number: A35526, Thermo Scientific) was used as a positive control. Cas9 cleavage was performed using TrueCut™ Cas9 Protein v2

(12) A GPX1-OSBPL8 axis mediates noncanonical in vivo ferroptosis and cancer growth suppressionCellApril 2, 2026Xia Z, Yang X, Samovich SN, Tyurina YY, Tyurin VA, Kon N, Zhang J, Jiang X, Stockwell BR, Jin J, et al.cotransfected gene TrueGuide Synthetic guide RNA or Negative Control non-targeting RNA (Invitrogen, A35526) with TrueCut Cas9 protein v2 by Lipofectamine CRISPRMAX Transfection Reagent. After 48 h transfection,

(13) Accelerated discovery of cell migration regulators using label-free deep learning-based automated trackingSci AdvMarch 13, 2026Tiffany Chu, Yeongseo Lim, Yufei Sun, Fan Wu, Carolina Castillo, Eban Hanna, Denis Wirtz, Pei-Hsun Wucell motility assay conditioning and analysis. Nontargeting sgRNA-treated (Thermo Fisher Scientific, A35526) cells and cells treated with Lipofectamine CRISPRMAX only were used as controls. Serum starvation

(14) HIF sustain a transcriptional regulatory circuit of EPAS1 expression in renal clear cell carcinomaNature CommunicationsFebruary 19, 2026Stephanie Naas, René Krüger, Steffen Grampp, Victoria Lauer, Andre Kraus, Julia Naas, Fabian Müller, Franziska Gsottberger, Mario Schiffer, Bernd Wullich, et al.Trueguide Synthetic sgRNA, Thermo Fisher Scientific, Waltham, MA, USA) or non-targeting control sgRNAs (A35526, TrueGuide sgRNA Negative Control, non-targeting, Thermo Fisher Scientific, Waltham, MA, USA) using

(15) Genetic evidence for PARP1 trapping as a driver of PARP inhibitor efficacy in BRCA mutant cancer cellsNucleic Acids ResDecember 11, 2025Jonathan Ribeiro, Kjetil Hansen, Lotte van Beek, Christopher Stubbs, Joan Frigola, Sara Talbot, Sabrina Bentouati, James Hall, Paul W G Wijnhoven, Josh Armenia, et al.AAAAUAUGAUAUGCUACAGA-3′, PARP2_C, 5′- GAGAGUUACCUGAGUAUUGG-3′) or non-targeting sgRNA (Invitrogen, #A35526) and Cas9 (Integrated DNA Technologies, #1 081 058) were diluted at 60 nM and 300 nM respectively in

(16) Secondary Necrosis Following Caspase‐Activation can Occur Independently of Gasdermin EAdvanced ScienceNovember 4, 2025Shubhangi Gavali, Francesca Maremonti, Wulf Tonnus, Florian Gembardt, Marlena Nastassja Schlecht, Karolin Flade, Anne von Mässenhausen, Stephen W. G. Tait, Stefan R. Bornstein, Andreas LinkermannDFNA5",Thermo Fisher Scientific,A35533 "TrueGuide Synthetic sgRNA, Negative control",Thermo Fisher Scientific,A35526 Reagents or resources and compounds and chemicals.

(17) Streptococcus pyogenes EVs induce the alternative inflammasome via caspase-4/-5 in human monocytesEMBO ReportsSeptember 8, 2025Kathrin Krause, Sandra Franch Arroyo, Matteo Ugolini, Tonya Kueck, Timothy J Sullivan, Eric J C Gálvez, Matthias Muenzner, Christian Goosmann, Volker Brinkmann, Christian K Frese, et al.gene,Provider,Guide RNA target sequence,Primer sequence (5’-3’),Primer sequence (5’-3’) Non-targeting,"A35526, Thermo Fisher",AAAUGUGAGAUCAGAGUAAU,n/a,n/a TLR2,Designed with Benchling software,TGTCCATATTTCCCACTCTC,F:

(18) The PURB–HOTAIR complex regulates p53-dependent promoter-specific transcriptional activationNature Structural & Molecular BiologySeptember 1, 2025Zhangchuan Xia, Ning Kon, Zhenyi Su, Jingjie Yi, Xu Hua, Hui Zhou, Zhiguo Zhang, Wei GuTrueCut Cas9 protein v2 (Invitrogen, A36498) along with scrambled nonspecific guide RNA (Invitrogen, A35526) or gene-specific TrueGuide synthetic guide RNAs (CRISPR760434_SGM, 5′-ATAGAACACTACGCGCAGCT-3′; CRISPR760433_SGM,

(19) Vav2 is a master regulator of repair against bacterial pore-forming toxinsbioRxivAugust 1, 2025Victor Gbenga Kayejo, Ashlee Hensley, Tejal Katore, Peter A. Keyelplates. After 24 h, these cells were transfected with either negative control guide RNA (Fisher catalog A35526), or guide RNA targeting Vav2 (Fisher catalog CRISPR957573_SGM, targeting CGCACATCGAAGAGGTCAAA

(20) Alpha-synuclein regulates nucleolar DNA double-strand break repair in melanomaSci AdvApril 11, 2025Moriah R. Arnold, Gabriel M. Cohn, Kezia Catharina Oxe, Somarr N. Elliott, Cynthia Moore, Allison May Zhou, Peter V. Laraia, Sahar Shekoohi, Dillon Brownell, Rosalie C. Sears, et al.gRNAs [Invitrogen TrueGuide Synthetic sgRNA (no. 35514), or negative control, non-targeting 1 (no. A35526)] using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen) according to the manufacturer’s

Be the First to Write a Review!

TrueGuide sgRNA Negative Control, non-targeting 1 from Thermo Fisher Scientific

Description

Thermo Fisher Scientific

Citations (55)

Reviews

TrueGuide sgRNA Negative Control, non-targeting 1 from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map