TrueGuide sgRNA Negative Control, non-targeting 1 from Thermo Fisher Scientific

Product Specs
ItemTrueGuide sgRNA Negative Control, non-targeting 1
CompanyThermo Fisher Scientific
Price $295.00Supplier Page View Company Product Page
Catalog NumberA35526
Quantity3 nmol
Regulatory StatusFor Research Use Only. Not for use in diagnostic procedures
TypesgRNA
Research AreaCell Analysis, Drug Screening, CRISPR Knockout Kits, Libraries, Gene Editing Services, High Throughput Screening,Expression Analysis, CRISPR Products, Molecular Biology Applications
RNA TypeCRISPR Negative Controls
Vector Type (Standardized)Synthetic

Add to Compare List

Thermo Fisher Scientific

168 Third Avenue

Waltham, MA 02451

United States

Phone: 800-678-5599

Company Profile

Website: www.thermofisher.com

(1) Trisomy 8 alters chromatin conformations and activates Y chromosome genes in stem cells to drive a pre-leukemic stateOncogeneMay 23, 2026Jie Bai, Kimi Araki, Daisuke Kurotaki, Eerdunduleng, Supannika Sorin, Kei Hiramatsu, Narumi Uno, Ai Hamashima, Mihoko Iimori, Kenta Kikuchi, et al.A35533) were mixed at a 1:1 ratio for transduction, and sgRNA non-targeting (Thermo Fisher Scientific, A35526) was used as a negative control. The electroporation of Cas9-sgRNA RNPs was performed as previously

(2) Targeting STAT5A via CRISPR/Cas9 restores TKI sensitivity in resistant chronic myeloid leukemia cellsMed OncolApril 25, 2026Besne Çelik, Yağmur Kiraz, Yaren Şahin, Burçin Tezcanlı Kaymazwas used as a negative control and TrueGuide™ sgRNA Positive Control, CDK4 (human) (catalog number: A35526, Thermo Scientific) was used as a positive control. Cas9 cleavage was performed using TrueCut™ Cas9 Protein v2

(3) Accelerated discovery of cell migration regulators using label-free deep learning-based automated trackingSci AdvMarch 13, 2026Tiffany Chu, Yeongseo Lim, Yufei Sun, Fan Wu, Carolina Castillo, Eban Hanna, Denis Wirtz, Pei-Hsun Wucell motility assay conditioning and analysis. Nontargeting sgRNA-treated (Thermo Fisher Scientific, A35526) cells and cells treated with Lipofectamine CRISPRMAX only were used as controls. Serum starvation

(4) HIF sustain a transcriptional regulatory circuit of EPAS1 expression in renal clear cell carcinomaNature CommunicationsFebruary 19, 2026Stephanie Naas, René Krüger, Steffen Grampp, Victoria Lauer, Andre Kraus, Julia Naas, Fabian Müller, Franziska Gsottberger, Mario Schiffer, Bernd Wullich, et al.Trueguide Synthetic sgRNA, Thermo Fisher Scientific, Waltham, MA, USA) or non-targeting control sgRNAs (A35526, TrueGuide sgRNA Negative Control, non-targeting, Thermo Fisher Scientific, Waltham, MA, USA) using

(5) A GPX1-OSBPL8 axis mediates noncanonical in vivo ferroptosis and cancer growth suppressionCellFebruary 19, 2026Zhangchuan Xia, Xin Yang, Sviatlana N. Samovich, Yulia Y. Tyurina, Vladimir A. Tyurin, Ning Kon, Jiankang Zhang, Xuejun Jiang, Brent R. Stockwell, Jian Jin, et al.cotransfected gene TrueGuide Synthetic guide RNA or Negative Control non-targeting RNA (Invitrogen, A35526) with TrueCut Cas9 protein v2 by Lipofectamine CRISPRMAX Transfection Reagent. After 48 h transfection,

(6) Genetic evidence for PARP1 trapping as a driver of PARP inhibitor efficacy in BRCA mutant cancer cellsNucleic Acids ResDecember 11, 2025Jonathan Ribeiro, Kjetil Hansen, Lotte van Beek, Christopher Stubbs, Joan Frigola, Sara Talbot, Sabrina Bentouati, James Hall, Paul W G Wijnhoven, Josh Armenia, et al.AAAAUAUGAUAUGCUACAGA-3′, PARP2_C, 5′- GAGAGUUACCUGAGUAUUGG-3′) or non-targeting sgRNA (Invitrogen, #A35526) and Cas9 (Integrated DNA Technologies, #1 081 058) were diluted at 60 nM and 300 nM respectively in

(7) Secondary Necrosis Following Caspase‐Activation can Occur Independently of Gasdermin EAdvanced ScienceNovember 4, 2025Shubhangi Gavali, Francesca Maremonti, Wulf Tonnus, Florian Gembardt, Marlena Nastassja Schlecht, Karolin Flade, Anne von Mässenhausen, Stephen W. G. Tait, Stefan R. Bornstein, Andreas LinkermannDFNA5",Thermo Fisher Scientific,A35533 "TrueGuide Synthetic sgRNA, Negative control",Thermo Fisher Scientific,A35526 Reagents or resources and compounds and chemicals.

(8) Streptococcus pyogenes EVs induce the alternative inflammasome via caspase-4/-5 in human monocytesEMBO ReportsSeptember 8, 2025Kathrin Krause, Sandra Franch Arroyo, Matteo Ugolini, Tonya Kueck, Timothy J Sullivan, Eric J C Gálvez, Matthias Muenzner, Christian Goosmann, Volker Brinkmann, Christian K Frese, et al.gene,Provider,Guide RNA target sequence,Primer sequence (5’-3’),Primer sequence (5’-3’) Non-targeting,"A35526, Thermo Fisher",AAAUGUGAGAUCAGAGUAAU,n/a,n/a TLR2,Designed with Benchling software,TGTCCATATTTCCCACTCTC,F:

(9) The PURB–HOTAIR complex regulates p53-dependent promoter-specific transcriptional activationNature Structural & Molecular BiologySeptember 1, 2025Zhangchuan Xia, Ning Kon, Zhenyi Su, Jingjie Yi, Xu Hua, Hui Zhou, Zhiguo Zhang, Wei GuTrueCut Cas9 protein v2 (Invitrogen, A36498) along with scrambled nonspecific guide RNA (Invitrogen, A35526) or gene-specific TrueGuide synthetic guide RNAs (CRISPR760434_SGM, 5′-ATAGAACACTACGCGCAGCT-3′; CRISPR760433_SGM,

(10) Alpha-synuclein regulates nucleolar DNA double-strand break repair in melanomaSci AdvApril 11, 2025Moriah R. Arnold, Gabriel M. Cohn, Kezia Catharina Oxe, Somarr N. Elliott, Cynthia Moore, Allison May Zhou, Peter V. Laraia, Sahar Shekoohi, Dillon Brownell, Rosalie C. Sears, et al.gRNAs [Invitrogen TrueGuide Synthetic sgRNA (no. 35514), or negative control, non-targeting 1 (no. A35526)] using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen) according to the manufacturer’s

(11) Multi-epitope immunocapture of huntingtin reveals striatum-selective molecular signaturesMolecular Systems BiologyApril 1, 2025Joshua L Justice, Todd M Greco, Josiah E Hutton, Tavis J Reed, Megan L Mair, Juan Botas, Ileana M Cristea5’-GAAGGACTTGAGGGACTCGA-3’; and Exon 3: 5’-CCCAGAAGTTTCTGAAATTC-3; and scrambled negative-control sgRNA (Invitrogen #A35526) were combined in equal molar ratios with TrueCut Cas9 Protein V2 (Invitrogen #A36499) in Opti-MEM (Thermo Fisher Scientific

(12) Gain-of-Function Chromatin Remodeling Activity of Oncogenic FOXL2C134W Reprograms Glucocorticoid Receptor Occupancy to Drive Granulosa Cell TumorsCancer researchMarch 3, 2025Welte T, Vuttaradhi VK, Khlebus EY, Brodsky A, Flores Legarreta A, Celestino J, Powell RT, Stephan CC, Nguyen N, Li J, et al.cat. #895347), supplemented with Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific, cat. #A35526), followed by clearance through 10 minutes of centrifugation at 2,350 g, 4°C before the assay procedure.

(13) TRAM-LAG1-CLN8 family proteins are acyltransferases regulating phospholipid compositionSci AdvFebruary 21, 2025Pradeep K. Sheokand, Andrew M. James, Benjamin Jenkins, Pawel K. Lysyganicz, Denis Lacabanne, Martin S. King, Edmund R. S. Kunji, Symeon Siniossoglou, Albert Koulman, Michael P. Murphy, et al.Concurrently, control wells were transfected with 6250 ng of Cas9 nuclease and 1200 ng of nontargeting gRNA (A35526, Thermo Fisher Scientific), resulting in control cell pools. The culture medium was refreshed 24 hours

(14) JUNB O‐GlcNAcylation‐Mediated Promoter Accessibility of Metabolic Genes Modulates Distinct Epithelial Lineage in Pulmonary FibrosisAdvanced ScienceDecember 15, 2024Marie‐Therese Bammert, Meshal Ansari, Leoni Haag, Zuhdi Ahmad, Victoria Schröder, Joseph Birch, Diana Santacruz, Werner Rust, Coralie Viollet, Benjamin Strobel, et al.(CRISPR887744_SGM); JUNB (CRISPR924803_SGM, CRISPR924804_SGM ratio 1:1 mixed); TrueGuide sgRNA Negative Control (#A35526). AAV6.2 Production Self‐complementary AAV6.2 vectors were produced and purified as previously described.[

(15) Impaired branched-chain amino acid (BCAA) catabolism during adipocyte differentiation decreases glycolytic fluxThe Journal of biological chemistryDecember 1, 2024Green CR, Alaeddine LM, Wessendorf-Rodriguez KA, Turner R, Elmastas M, Hover JD, Murphy AN, Ryden M, Mejhert N, Metallo CM, et al.Thermo Fisher Scientific, 15-140-122). Results were compared with TrueGuide sgRNA Negative Control (A35526, Thermofischer Scientific). Induction of differentiation started next for 13 days by adding an adipogenic

(16) MAPK phosphatase 1 inhibition of p38α within lung myofibroblasts is essential for spontaneous fibrosis resolutionJournal of Clinical InvestigationMay 15, 2024Sean M. Fortier, Natalie M. Walker, Loka R. Penke, Jared D. Baas, Qinxue Shen, Jennifer M. Speth, Steven K. Huang, Rachel L. Zemans, Anton M. Bennett, Marc Peters-GoldenMAPK12, 5′-CTCATGAAACATGAGAAGCT-3′. The NT sequence 5′-AAATGTGAGATCAGAGTAAT-3′ (Thermo Fisher Scientific, A35526) was likewise incorporated into TLCV2 and used as a negative control. Polybrene (2 μg/mL, MilliporeSigma,

(17) MerTK Drives Proliferation and Metastatic Potential in Triple-Negative Breast CancerInternational Journal of Molecular SciencesMay 8, 2024Mari Iida, Bridget E. Crossman, Kourtney L. Kostecki, Christine E. Glitchev, Carlene A. Kranjac, Madisen T. Crow, Jillian M. Adams, Peng Liu, Irene Ong, David T. Yang, et al.(CRISPR768842 and CRISPR1060035, Invitrogen, Waltham, MA, USA) or TrueGuide sgRNA Negative Control (#A35526) using Invitrogen TrueCut Cas9 v2 and Lipofectamine CRISPRMAX (Invitrogen) according to the manufacturer’s

(18) Thioredoxin is a metabolic rheostat controlling regulatory B cellsNature immunologyMay 1, 2024Bradford HF, McDonnell TCR, Stewart A, Skelton A, Ng J, Baig Z, Fraternali F, Dunn-Walters D, Isenberg DA, Khan AR, et al.guide RNAs (gRNAs) were purchased from IDT. TrueGuide sgRNA Negative Control (ThermoFisher, cat. no. A35526) was used as a nontargeting gRNA control. A cocktail of nucleofection reagents was prepared: per reaction,

(19) DNA-PK and ATM drive phosphorylation signatures that antagonistically regulate cytokine responses to herpesvirus infection or DNA damageCell SystemsApril 17, 2024Joshua L. Justice, Tavis J. Reed, Brett Phelan, Todd M. Greco, Josiah E. Hutton, Ileana M. CristeaHope,N/A Oligonucleotides,Oligonucleotides,Oligonucleotides Trueguide sgRNA (SCR Control),Thermo Fisher Scientific,A35526 Trueguide sgRNA (IFI16),Thermo Fisher Scientific,CRISPR1100935_SGM Trueguide sgRNA (PRKDC),Thermo

(20) PHLDA2-mediated phosphatidic acid peroxidation triggers a distinct ferroptotic response during tumor suppressionCell metabolismApril 2, 2024Yang X, Wang Z, Samovich SN, Kapralov AA, Amoscato AA, Tyurin VA, Dar HH, Li Z, Duan S, Kon N, et al.TrueGuide Synthetic guide RNA (Invitrogen, A35533) or Negative Control non-targeting RNA (Invitrogen, A35526) with TrueCut Cas9 protein v2 by Lipofectamine CRISPRMAX Transfection Reagent. After 48 h transfection,

Be the First to Write a Review!

TrueGuide sgRNA Negative Control, non-targeting 1 from Thermo Fisher Scientific

Description

Thermo Fisher Scientific

Citations (45)

Reviews

TrueGuide sgRNA Negative Control, non-targeting 1 from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map