GoScript Reverse Transcriptase from Promega

Product Specs
ItemGoScript Reverse Transcriptase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA5004
Quantity500 reactions

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(61) CRISPR/Cas9-Mediated Knockout of tnfaip1 in Zebrafish Plays a Role in Early DevelopmentGenesApril 28, 2023Huang S, Zhang H, Chen W, Su N, Yuan C, Zhang J, Xiang S, Hu X.Takara, Okinawa, Japan). cDNA was, subsequently, synthesized using GoScript™ reverse transcriptase (A5003, Promega, Madison, WI, USA). In this study, 18SrRNA was used as an internal reference gene used for

(62) Extending the toolbox for RNA biology with SegModTeX: A polymerase-driven method for site-specific and segmental labeling of RNAResearch SquareApril 26, 2023Raphael Haslecker, Vincent V. Pham, David Glänzer, Christoph Kreutz, Theodore Kwaku Dayie, Victoria M. D'Souzashort (25 nt) primer (5′TCCATGACTCATGAACAAGAGACCC3′) using GoScript™ Reverse Transcriptase (Promega A5003). PCR amplification of the RT product was done with EconoTaq® PLUS (LGC Biosearch Technologies #300331)

(63) Disruption of the ABA1 encoding zeaxanthin epoxidase caused defective suberin layers in Arabidopsis seed coatsFrontiers in Plant ScienceMarch 15, 2023Jeongho Choi, Hyojin Kim, Mi Chung Suhisolated total RNA was used to synthesize complementary DNA using GoScript Reverse Transcriptase (Promega, A5003), following the manufacturer’s instructions. The obtained cDNA was used for RT-PCR and RT-qPCR analyses.

(64) Lung versus gut exposure to air pollution particles differentially affect metabolic health in miceParticle and Fibre ToxicologyMarch 9, 2023Angela J. T. Bosch, Theresa V. Rohm, Shefaa AlAsfoor, Andy J. Y. Low, Lena Keller, Zora Baumann, Neena Parayil, Marc Stawiski, Leila Rachid, Thomas Dervos, et al.Plus Universal Mini kit (Cat# 73404, QIAGEN). Reverse transcription was performed with GoScript™ (Cat# A5003, Promega). GoTaq qPCR Master Mix (Cat# A4472919, Promega) was used for real-time PCR (ViiA7, Thermo

(65) Network-informed discovery of multidrug combinations for ERα+/HER2-/PI3Kα-mutant breast cancerCellular and Molecular Life SciencesMarch 3, 2023Dina Hany, Marloes Zoetemelk, Kaushik Bhattacharya, Patrycja Nowak-Sliwinska, Didier Picard400 ng total RNA, random primers (Promega #C1181), and GoScript reverse transcriptase kit (Promega #A5003). Then, GoTaq qPCR Master Mix kit (Promega #A6001) and specific primers were used to set up the quantitative real-time PCR

(66) Polarized Anti-Inflammatory Mesenchymal Stem Cells Increase Hippocampal Neurogenesis and Improve Cognitive Function in Aged MiceInternational journal of molecular sciencesFebruary 24, 2023Tfilin M, Gobshtis N, Fozailoff D, Fraifeld VE, Turgeman G.of total RNA was reverse transcribed using GoScript™ Reverse Transcription System (Promega, cat No. A5003). After reverse transcription, real-time PCR analysis by real-time PCR QuantStudioTM machine was conducted

(67) The aryl hydrocarbon receptor cell intrinsically promotes resident memory CD8(+) T cell differentiation and functionCell reportsJanuary 31, 2023Dean JW, Helm EY, Fu Z, Xiong L, Sun N, Oliff KN, Muehlbauer M, Avram D, Zhou L.Kit,Takara,Cat# 634456 iDeal ChIP-Seq,Diagenode,Cat# C01010055 GoScript Reverse Transcriptase,Promega,Cat# A5003 Zombie Aqua Fixable Viability Kit,BioLegend,Cat# 423102 Live and Dead Violet Viability Kit,Invitrogen,Cat#

(68) Vacuole Membrane Protein 1 (VMP1) Restricts NLRP3 Inflammasome Activation by Modulating SERCA Activity and AutophagyResearch squareJanuary 27, 2023Zack SR, Nikolaienko R, Cook B, Melki R, Zima AV, Campbell EM.(Macherey-Nagel, 740984.250). cDNA was synthesized using the GoScript Reverse Transcriptase System (Promega, A5004). Quantitative PCR was performed using gene specific primers and Itaq™ Universal SYBR (Bio-Rad, 1725124).

(69) Unique expression of the atypical mitochondrial subunit NDUFA4L2 in cerebral pericytes fine tunes HIF activity in response to hypoxiaJournal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and MetabolismJanuary 1, 2023Mesa-Ciller C, Turiel G, Guajardo-Grence A, Lopez-Rodriguez AB, Egea J, De Bock K, Aragonés J, Urrutia AA.µg RNA was then reverse – transcribed for cDNA synthesis using GoScript™ Reverse Transcriptase Kit (A5004, Promega, Madison, WI, USA). PCR amplifications were then performed using the SYBR™ Power SYBR™ Green PCR Master Mix

(70) Suppression of YAP safeguards human naïve pluripotencyDevelopmentDecember 15, 2022Anish Dattani, Tao Huang, Corin Liddle, Austin Smith, Ge Guoa ReliaPrep kit (Promega, Z6012) and cDNA synthesised with GoScript reverse transcriptase (Promega, A5004) and 3′Race (oligo dT) adaptor primers. TaqMan assays (Thermo Fisher Scientific) and Universal Probe

(71) PD-L1-directed PlGF/VEGF blockade synergizes with chemotherapy by targeting CD141(+) cancer-associated fibroblasts in pancreatic cancerNature communicationsOctober 22, 2022Kim DK, Jeong J, Lee DS, Hyeon DY, Park GW, Jeon S, Lee KB, Jang JY, Hwang D, Kim HM, et al.ng to 1 μg) was reverse-transcribed to cDNA using the GoScriptTM reverse transcriptase kit (Promega, A5003). Following primer validation (Supplementary Table 1), SYBRTM Green PCR Master Mix kit was used to carry

(72) Multi-hallmark long noncoding RNA maps reveal non-small cell lung cancer vulnerabilitiesCell GenomSeptember 14, 2022Esposito R, Polidori T, Meise DF, Pulido-Quetglas C, Chouvardas P, Forster S, Schaerer P, Kobel A, Schlatter J, Kerkhof E, et al.reverse transcribed to produce cDNAs by using the GoScript Reverse Transcription System Kit (Promega #A5003). The cDNAs were then used for qPCR to evaluate gene expression, using the GoTaq qPCR Master Mix kit

(73) Global and precise identification of functional miRNA targets in mESCs by integrative analysisEMBO reportsSeptember 5, 2022Schaefer M, Nabih A, Spies D, Hermes V, Bodak M, Wischnewski H, Stalder P, Ngondo RP, Liechti LA, Sajic T, et al.Kit,Illumina,Cat.no. MRZG12324 RQ1 RNase‐Free DNase Kit,Promega,M6101 GoScript Reverse Transcriptase,Promega,A5004 miScript II RT Kit,Qiagen,Cat No./ID: 218161 DC Protein Assay Reagent,Bio‐rad,5000113‐5 Clarity Western

(74) Silencing of hypothalamic FGF11 prevents diet-induced obesityMolecular BrainSeptember 5, 2022Jae Hyun Cho, Kyungchan Kim, Han Chae Cho, Jaemeun Lee, Eun-Kyoung Kimspectrophotometer (DeNovix, DS-11). Total RNA, reaction buffer, and GoScript Reverse Transcriptase (Promega, A5004) were mixed in a total volume of 20 μl and reverse transcription was carried out in a thermal cycler

(75) Regulation of mitochondrial proteostasis by the proton gradientThe EMBO journalAugust 16, 2022Patron M, Tarasenko D, Nolte H, Kroczek L, Ghosh M, Ohba Y, Lasarzewski Y, Ahmadi ZA, Cabrera-Orefice A, Eyiama A, et al.(Macherey‐Nagel; 740,955.250) before generating cDNA with Promega GoScript Reverse Transcriptase kit (Cat# A5003) and adjusting to 10 μg/ml. PCR was performed with SYBR Green PCR mix (applied biosystems; Cat# 4309155),

(76) Antioxidant and Anti-Inflammatory Activities of Coenzyme-Q10 and Piperine against Cyclophosphamide-Induced Cytotoxicity in HuH-7 CellsBioMed Research InternationalJuly 13, 2022Norah S. AL-Johani, Mohammed Al-Zharani, Nada H. Aljarba, Norah M. Alhoshani, Nora Alkeraishan, Saad AlkahtaniUSA). 2.5.2. Complementary DNA (cDNA) Synthesis cDNA synthesis kit GoScript™ Reverse Transcriptase (CAT No A5003, Promega, USA) was carried out according to manufacturer instructions. Briefly, 0.5 μl Oligo (dT) and

(77) Gilteritinib Enhances Anti-Tumor Efficacy of CDK4/6 Inhibitor, Abemaciclib in Lung Cancer CellsFrontiers in PharmacologyJune 23, 2022Chao-Yue Sun, Milton Talukder, Di Cao, Cun-Wu Chenmanufacturer’s instruction. Then, cDNA was obtained using the GoScript Reverse Transcriptase kit (Promega, A5004). Real-time quantitative PCR (qRT-PCR) analysis was performed with GoTaq qPCR Master Mix kit (Promega,

(78) A single amino acid residue controls acyltransferase activity in a polyketide synthase from Toxoplasma gondiiiScienceJune 17, 2022Hannah K. D’Ambrosio, Jack G. Ganley, Aaron M. Keeler, Emily R. Derbyshireproteins" ,, ProSignal® Femto ECL Reagent,Prometheus,Cat # 20-302 GoScript Reverse Transcription System,Promega,Cat# A5003 Ni-NTA agarose,Qiagen,Cat# 30210 cOmplete Ultra EDTA-free,Sigma,Cat# 5892953001 Q5® High-Fidelity DNA Polymerase

(79) Rapid fluorescent vital imaging of olfactory epitheliumiScienceMay 20, 2022Nishijima H, Zunitch MJ, Yoshida M, Kondo K, Yamasoba T, Schwob JE, Holbrook EH.assays ,, Quick-RNA Miniprep,ZYMO RESEARCH,Cat# R1054 GoScript Reverse Transcriptase,Promega,Cat# A5003 2X SYBR Green qPCR Master Mix,Genesee Scientific,Cat# 42-116PG ,, Deposited data,Deposited data,Deposited

(80) Novel Loss-of-Function Variants in CHD2 Cause Childhood-Onset Epileptic Encephalopathy in Chinese PatientsGenes (Basel)May 19, 2022Xu Wang, Di Cui, Changhong Ding, Chunhong Chen, Xiaohui Wang, Fang Fang, Hong Jin, Xiaotun Renquantified, RNA was reversed transcribed to cDNA using the GoScript™ Reverse Transcriptase (Promega, A5003). PCR amplification and agarose gel electrophoresis were then performed for the splicing-site variant,

Be the First to Write a Review!