GoScript Reverse Transcriptase from Promega

Product Specs
ItemGoScript Reverse Transcriptase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA5004
Quantity500 reactions

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(41) Machine learning‑based construction of damage‑associated molecular patterns related score identifies subtypes of pancreatic adenocarcinoma with distinct prognosisOncology LettersMarch 24, 2025Jing Liang, Hui Wu, Zewen Song, Guoyin Li, Jianfeng Zhang, Wenxin DingScientific, Inc.). cDNA synthesis was performed according to the manufacturer's instructions (cat. no. A5003; GoScript™ Reverse Transcriptase from Promega Corp.). RT-qPCR was conducted as previously described

(42) Extracellular Vesicles from Regenerating Skeletal Muscle Mitigate Muscle Atrophy in an Amyotrophic Lateral Sclerosis Mouse ModelCellsMarch 20, 2025Jinghui Gao, Aria Sikal, Rachel Hankin, Yaochao Zheng, Elijah Sterling, Kenny Chan, Yao Yaointo complementary DNA (cDNA) using the GoScript Reverse Transcriptase kit (Promega, Madison, WI, USA, A5003). Quantitative real time-PCR (qRT-PCR) was performed to measure messenger RNA (mRNA) expression of IL-10

(43) Transcriptomic Profiling Reveals Differences in Slow‐Twitch and Fast‐Twitch Muscles of a Cigarette Smoke‐Exposed Rat ModelJournal of Cachexia, Sarcopenia and MuscleFebruary 1, 2025Timothy K. H. Fung, Kwok Kuen Cheung, Xia Wang, Benson W. M. Lau, Shirley P. C. Ngaifrom the extracted RNA using the GoScript™ Reverse Transcriptase Kit (Promega Corporation, USA, Cat. A5003). cDNA amplification was conducted using a CFX Connect Real‐Time PCR Detection System (Bio‐Rad Laboratories,

(44) YTHDF2 promotes ATP synthesis and immune evasion in B cell malignanciesCellJanuary 23, 2025Zhenhua Chen, Chengwu Zeng, Lu Yang, Yuan Che, Meiling Chen, Lillian Sau, Bintao Wang, Keren Zhou, Yu Chen, Ying Qing, et al.Scientific,A456-1 ZymoTaq PreMix,Zymo Research,Cat# E2004 GoScript Reverse Transcrptase,Promega,Cat# A5003 Recombinant YTHDF1,Active Motif,Cat# 31608 Recombinant YTHDF2,Active Motif,Cat# 31573 Recombinant

(45) Impacts of hnRNP A1 Splicing Inhibition on the Brain Remyelination ProteomeJ NeurochemJanuary 22, 2025Caroline Brandão-Teles, Victor Corasolla Carregari, Guilherme Reis-de-Oliveira, Bradley J. Smith, Yane Chaves, Aline Valéria Sousa Santos, Erick Martins de Carvalho Pinheiro, Caio C. Oliveira, Andre Schwambach Vieira, Fernanda Crunfli, et al.generate cDNA, 500 ng of RNA was reverse transcribed using the Promega reverse transcription kit (cat# A5003). For each 10 μL of the qPCR reaction, 1 μL of cDNA diluted 1:10 was mixed with 200 nM of the primers

(46) Inhibition of EETosis with an anti-citrullinated histone antibody: a novel therapeutic approach for eosinophilic inflammatory disordersFrontiers in immunologyJanuary 1, 2025Zwiers E, Montizaan D, Kip A, Waaijenberg K, Fichtinger PS, Mathur SK, Fujioka Y, Ueki S, van Es H, Chirivi RGS, et al.using RNeasy columns (Qiagen, 74106) and cDNA was made using GoScript reverse transcriptase (Promega, A5004). Equal volumes of cDNA from each sample were added to a solution of 1x SYBR green master mix (Applied Biosystems

(47) Releasing a sugar brake generates sweeter tomato without yield penaltyNatureNovember 21, 2024Jinzhe Zhang, Hongjun Lyu, Jie Chen, Xue Cao, Ran Du, Liang Ma, Nan Wang, Zhiguo Zhu, Jianglei Rao, Jie Wang, et al.Biotechnology), and the RNA was reverse transcribed, using GoScript Reverse Transcriptase (catalogue no. A5003; Promega), according to the manufacturer’s instructions. qPCR was performed using GoScript qPCR Master Mix

(48) Single-cell RNA sequencing analysis reveals the role of TXNDC5 in keloid formationCytojournalOctober 31, 2024Zhikun Liu, Lining Xian, Jianmin Li, Shudan Zheng, Hongju Xiewere collected and total RNA (1 mg) was extracted with the GoScript Reverse Transcription System kit (A5003, Promega Corporation, Madison, Wisconsin, USA). After quantification and synthesis of cDNA, quantitative

(49) Single-cell RNA sequencing analysis reveals the role of TXNDC5 in keloid formationCytojournalOctober 31, 2024Zhikun Liu, Lining Xian, Jianmin Li, Shudan Zheng, Hongju Xiewere collected and total RNA (1 mg) was extracted with the GoScript Reverse Transcription System kit (A5003, Promega Corporation, Madison, Wisconsin, USA). After quantification and synthesis of cDNA, quantitative

(50) NRXN1 as a Prognostic Biomarker: Linking Copy Number Variation to EMT and Survival in Colon CancerInternational journal of molecular sciencesOctober 24, 2024Bang HJ, Shim HJ, Park MR, Yoon S, Yoo KH, Kim YK, Lee H, Nam JS, Hwang JE, Bae WK, et al.reagent (Cat. No. 305–101; GeneAll Biotechnology, Seoul, Republic of Korea) and a GoScript kit (Cat. No. A5003; Promega, Madison, WI, USA), respectively, following the manufacturers’ protocols. RT-qPCR analysis

(51) TRAF7 determines circadian period through ubiquitination and degradation of DBPCommunications BiologyOctober 8, 2024Shusaku Masuda, Nobuhiro Kurabayashi, Rina Nunokawa, Yuta Otobe, Hiroko Kozuka-Hata, Masaaki Oyama, Yuri Shibata, Jun-ichiro Inoue, Michinori Koebis, Atsu Aiba, et al.manufacturer’s protocol. From purified RNA, cDNA was generated by Go Script Reverse Transcriptase (Promega, A5003) with both anchored (dT) 15 primer and random oligo primers or ReverTra Ace qPCR Master Mix (TOYOBO,

(52) Transcriptomic analysis of plasma-derived small extracellular vesicles reveals the pathological characteristics of normal tension glaucomaExtracellular Vesicles and Circulating Nucleic AcidsAugust 19, 2024Sheng-Lan Xu, Jun-Hua Li, Wen-Meng Zhang, Meng-Jun Fu, Hui-Min Xing, Hua Ma, Xian-Hui Gong, Rong-Han Wu, Yuan-Bo Liang, Ren-Zhe Cui, et al.Reverse transcription of mitochondrial RNA was performed using the GoScript Reverse transcription System (A5004, Promega, USA). Real-time PCR was performed using Taq pro Universal SYBR qPCR Master Mix (Q712-02, Vazyme,

(53) Identification and Comprehensive Analysis of OFP Genes for Fruit Shape Influence in MangoGenes (Basel)June 21, 2024Qiuping Wu, Rui Xia, Jie Yang, Rong Chen, Zaohai Zeng, Chao FanFirst-strand cDNA was synthesized from 1 μg total RNA using the GoScript Reverse Transcriptase (Promega, A5003). Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was performed using THUNDERBIRD

(54) hnRNPM protects against the dsRNA-mediated interferon response by repressing LINE-associated cryptic splicingMolecular CellJune 6, 2024Rong Zheng, Mikayla Dunlap, Georg O.M. Bobkov, Carlos Gonzalez-Figueroa, Khushali J. Patel, Jingyi Lyu, Samuel E. Harvey, Tracey W. Chan, Giovanni Quinones-Valdez, Mudra Choudhury, et al.cDNA was generated via reverse transcription using the GoScript Reverse Transcription System (Promega, A5004) with 1 ul GoScript RT and 250 ng of RNA in a total volume of 20ul followed by incubation at 25 °C for

(55) Xrp1 governs the stress response program to spliceosome dysfunctionNucleic acids researchMarch 21, 2024Stanković D, Tain LS, Uhlirova M.retention assay cDNA was synthesized from 2 μg of total RNA using GoScript Reverse Transcriptase (Promega #A5003) with random hexamers according to the manufacturer’s protocol. Quantitative polymerase chain reaction (PCR

(56) Overexpression of NtGPX8a Improved Cadmium Accumulation and Tolerance in Tobacco (Nicotiana tabacum L.)Genes (Basel)March 15, 2024Xiang Peng, Tengfei Ma, Kejin Song, Xue Ji, Lien Xiang, Nan Chen, Ronglei Zu, Wenyi Xu, Shunqin Zhu, Wanhong Liufirst-strand cDNA synthesis was carried out using the GoScriptTM Reverse Transcription System (No. A5003, Promega, Madison, WI, USA). The synthesized cDNA was utilized for subsequent qPCR analysis. The qPCR

(57) Impaired influenza A virus replication by the host restriction factor SAMHD1 which inhibited by PA-mediated dephosphorylation of the host transcription factor IRF3Virology JournalJanuary 29, 2024Zhilei Zhao, Shuyi Han, Qingxun Zhang, Ye Wang, Kening Yue, Salbia Abbas, Hongxuan Heof RNA were reverse transcribed into cDNA using the GoScript™ Reverse Transcriptase System (Promega, A5004). RT‒qPCR was performed on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems, Carlsbad, CA)

(58) Analogs of FTY720 inhibit TRPM7 but not S1PRs and exert multimodal anti-inflammatory effectsJournal of General PhysiologyJanuary 1, 2024Gregory W. Busey, Mohan C. Manjegowda, Tao Huang, Wesley H. Iobst, Shardul S. Naphade, Joel A. Kennedy, Catherine A. Doyle, Philip V. Seegren, Kevin R. Lynch, Bimal N. Desaiusing RNeasy Plus Micro Kit (74134; Qiagen). cDNA was produced using GoScript Reverse Transcriptase (A5004; Promega) and a quantitative PCR was performed using SensiFast SYBR (98020; Bioline) and Bio-Rad CFX

(59) Dysregulated complement activation during acute myocardial infarction leads to endothelial glycocalyx degradation and endothelial dysfunction via the C5a:C5a-Receptor1 axisFrontiers in immunologyJanuary 1, 2024Vahldieck C, Löning S, Hamacher C, Fels B, Rudzewski B, Nickel L, Weil J, Nording H, Baron L, Kleingarn M, et al.was synthesized with the Go Script Reverse Transcriptase (Promega GmbH, Walldorf, Germany; catalog: A5003) and random hexamer primers (Thermo Fisher Scientific; catalog: SO142) according to the instructions

(60) Extending the toolbox for RNA biology with SegModTeX: a polymerase-driven method for site-specific and segmental labeling of RNANat CommunDecember 18, 2023Raphael Haslecker, Vincent V. Pham, David Glänzer, Christoph Kreutz, Theodore Kwaku Dayie, Victoria M. D'Souzashort (25-nt) primer (5’TCCATGACTCATGAACAAGAGACCC3’) using GoScript™ Reverse Transcriptase (Promega A5003). PCR amplification of the RT product was done with EconoTaq® PLUS (LGC Biosearch Technologies #300331)

Be the First to Write a Review!