Dual-Luciferase Reporter Assay System E1910 from Promega

Product Specs
ItemDual-Luciferase Reporter Assay System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberE1910
ReactivityMammalian
Detection TargetLuciferase
SpeciesMammalian
MethodLuciferase
Sample TypeMammalian cells
Assay Time4 seconds
Sensitivityattomole (< />^-18) sensitivities
Quantity100 assays
Molecular Weight~72kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Downregulation of the lncRNA PGM5P4-AS1 predicts poor prognosis and drives breast cancer progression through miR-3664-5p/KLF9Cancer Biol TherDecember 31, 2026Yifan Wu, Jiangdong Jin, Yuhan Zhang, Xiaoya Huang, Hanjia Wang, Yue Huang, Hui XieAfter 48 h, luciferase activity was measured using a dual-luciferase reporter assay kit (catalog no. E1910, Promega). RNA immunoprecipitation (RIP) assay A Magna RIP RNA-binding protein immunoprecipitation

(2) Identification of coilin in bone marrow as a potential neuroblastoma tumor progression marker transcriptionally regulated by MYCNCancer Biol TherDecember 31, 2026Zhixia Yue, Lan Li, Shuguang Liu, Chao Gao, Sidou He, Tianlin Xue, Wen Zhao, Chunying Cui, Chao Duan, Yan SuLuciferase reporter assay For luciferase reporter assays, we used the Dual-Luciferase Reporter Assay System (E1910, Promega). The experiment is divided into six groups with each group repeated three times. Luciferase

(3) Prenatal bisphenol A exposure reprograms SF1-lactylation pathways to promote endometriosis susceptibilityiScienceMay 15, 2026Xiaohan Liu, Yanxia Fu, Liuxuan Huang, Donghan Li, Paul Yao, Liqin Zengsoftware,Primer3,RRID:SCR_003139 ,, Other,Other,Other ,, Dual-Luciferase Reporter Assay System,Promega,Cat# E1910 Confocal microscope (TCS SP8),Leica Microsystems,Model TCS SP8

(4) Heart failure pleural fluid impairs endothelial barrier through miR 501-3p mediated ZO 1 remodelingiScienceMay 15, 2026Chieh-Yung Wang, Tung-Yu Tiong, Ying Chen, Yi-Hsuan Lin, Vijesh Kumar Yadav, Chih-Ying Changchien, Chih-Feng Chian, Chen-Liang Tsai13778075 Lipofectamine 2000,Thermo Fisher Scientific,Cat# 11668019 Dual-Luciferase Reporter Assay System,Promega,Cat# E1910 DCFH-DA,Sigma-Aldrich,Cat# D6883 FITC-Dextran,Merck Millipore,Cat# FD70S Matrigel Basement Membrane

(5) Methyltransferase complex subunit METTL3 maintains genome stability of erythroid cells via MTHFD1-mediated nucleotide biosynthesisJournal of Clinical InvestigationMay 1, 2026Linlin Zhang, Huizhi Zhao, Shihui Wang, Xueting Wu, Donghao Liu, Hengchao Zhang, Qianqian Yang, Ying Cheng, Xiuyun Wu, Jiangwei Zhao, et al.Luciferase activities were then measured using the Dual-Luciferase Reporter Assay System (Promega, E1910) according to the manufacturer’s instructions, with firefly luciferase (Fluc) signals normalized to

(6) Small extracellular vesicles derived from hair follicle neural crest stem cells enhance perineurial cell proliferation and migration via the TGF-β/SMAD/HAS2 pathwayNeural Regeneration ResearchMay 1, 2026Yiming Huo, Bing Xiao, Haojie Yu, Yang Xu, Jiachen Zheng, Chao Huang, Ling Wang, Haiyan Lin, Jiajun Xu, Pengfei Yang, et al.(Cat# L11668030, Invitrogen). After 48 hours, the dual-luciferase reporter gene assay system (Cat# E1910, Promega, Madison, WI, USA) was used following the manufacturer’s instructions. Relative luciferase

(7) Urinary exosomes aggravate diabetic kidney disease by inducing podocyte ferroptosis via the miR-217/SIRT1/Nrf2 pathwayJ Cell Commun SignalApril 25, 2026Xin Du, Yubo Jiang, Hongbin Guo, Haiying Zhang, Shaoqing Wang, Hao Deng, Xinyi Huang, Xiu Lih, luciferase activity was detected based on the protocol of Dual‐Luciferase Reporter Assay System (E1910, Promega). 2.9 Real‐time qPCR analysis Total RNA was isolated from exosomes or cells using total RNA

(8) MYC-bound enhancer RNAs in cis regulate gene transcription and tumorigenesisSci AdvApril 24, 2026Sihan Li, Zehua Wang, Phuong Nguyen, Yue Wang, Yueshan Zhao, Yifei Wang, Yuang Chen, Haozhe Huang, Xiaofei Wang, Yu Zhang, et al.cells were subjected to the luciferase assay with the Dual-Luciferase Reporter Assay System (Promega, E1910), and the luciferase activities were measured in a Wallac Victor2 1420 Multilabel Counter (Perkin Elmer). In

(9) Integrated drivers of basal and acute immunity in diverse human populationsCell Reports MedicineApril 21, 2026Aisha Hegab Souquette, E. Kaitlynn Allen, Christine M. Oshansky, Evadnie Rampersaud, Emily V. Walker, Li Tang, Sook-San Wong, Trushar Jeevan, Lei Shi, Stanley Pounds, et al.collected and luciferase expression was measured using the Dual-Luciferase Assay kit (Promega Cat. E1910) on the GloMax platform in accordance with the kit protocol. For influenza stimulated results, at 24

(10) Enalaprilat reverses neutrophil polarization imbalance via targeting taurine-STING axis for treatment of diabetic woundsCell Reports MedicineApril 21, 2026Li Lu, Yuan Xiong, Jiewen Liao, Juan Zhou, Guangji Wang, Yating Qin, Shengming Zhang, Yanzhi Zhao, Xiaodan Zhong, Mengwen Wang, et al.kit,Dojindo,Cat#CK04 ChIP assay kit,Beyotime,Cat#P2078 Dual-luciferase reporter assay kit,Promega,Cat#E1910 EdU cell proliferation kit,Beyotime,Cat#C0078S FerroOrange assay kit,Dojindo,Cat#F374 Hiscript III

(11) ASCL2 drives colorectal cancer metastasis through transcriptional activation of TDGF1Cell Oncol (Dordr)April 20, 2026Defu Li, Hui Wang, Zhengping Yu, Yuanbing Zhang, Jie Zhang, Xiang Tao, Fangping Wang, Shiwen Luo, Quqin Luincubation, dual-luciferase activity was quantified using the Dual-Luciferase® Reporter Assay system (E1910; Promega, USA), and firefly luciferase signals were normalized to Renilla luminescence. The pGL4.2-ATG9B-promoter-Luc

(12) Targeting the PPAR-γ/OPTN axis to inhibit apoptosis in steroid-induced glaucomaiScienceApril 17, 2026Xin Liang, Ning Li, Qiaoyun Gong, Haiyan WangChromatin IP Kit,Cell Signaling Technology,Cat#9003 dual-luciferase Reporter Assay System,Promega,Cat#E1910 ,, Deposited data,Deposited data,Deposited data ,, RNA-seq data,NCBI SRA,PRJNA1416612 Proteomic

(13) ATF6 ameliorates renal warm ischemia-reperfusion injury through FHL2 -mediated NF-κb signaling pathwayiScienceApril 17, 2026Xuan Wu, Ji-Hua Shi, Yang Bai, Dong-Jing Yang, Meng-Yao Jia, Dan-Feng Guo, Jia-Kai Zhang, Xiao-Yi Shi, Hua-Peng Zhang, Wen-Zhi Guo, et al.into 293T cells. Luciferase activity was measured using the Dual-Luciferase Reporter Assay System (E1910, Promega, Beijing, China) and normalized to Renilla luciferase activity. Co-immunoprecipitation (Co-IP) For

(14) Multifaceted Role of POU5F1P1 in Regulating Its Parental Stem Cell Gene, POU5F1iScienceApril 17, 2026Kyohei Irie, Mitsuko Kosaka, Nobuhiko Mizuno, Ryo Omae, Yoshimasa Nakatani, Sandi Myat Noe Noe Oo, Hisashi Masuyama, Ayano Kawaguchiassays ,, Neon Transfection System,Thermo Fisher Scientific,#MPK10025 Dual-Luciferase® Kit,Promega,#E1910 PrimeScript II first-strand cDNA synthesis kit,Takara,#6210A/B ,, Deposited data,Deposited data,Deposited

(15) 2'-O-Methylation maintains ribosome structural and translation integrityMol CellApril 16, 2026Yu Zhao, Jay Rai, Lauren N. Cohen, Yuerong Shu, Chong Xu, Hemant Goswami, Xin Chen, Hong Jin, Virginie Marchand, Yuri Motorin, et al.Click-iT™ HPG Alexa Fluor™ 488 Protein Synthesis Assay Kit,ThermoFisher,C10428 Dual-Luciferase Reporter Assay System,Promega,E1910 OLIGONUCLEOTIDES,SOURCE,IDENTIFIER CATCGGTATACTACTGTTATATAAGTTATTC,Eurofins,Nop1_seq_F CTATTTTACAAAGTCGAGGGTTACAAAAAC,Eurofins,Nop1_seq_R GACTATGTGGTTCAATAACGACCT,Eurofins,FBL_gRNA251F AAACAGGTCGTTATTGAACCACAT,Eurofins,FBL_gRNA251R GACTTAATACGAGCTTGATCAGGC,Eurofins,FBL_gRNA735F AAACGCCTGATCAAGCTCGTATTA,Eurofins,FBL_gRNA735R GCATTAGCTGCTGGCATCATGGGTGGTCTAGATGAATTATTTATTGCCCCAGGCAAGAAAGTTTTA,Eurofins,Nop1_temp150_F CATGATGCCAGCAGCTAATGCAGATCTGAATGGGTTCCATACACGGTATTCGACCTTGGTTGGTGG,Eurofins,Nop1_temp150_R TTAGAGGTGAAGTAGAAATAAACCAAGAAAGCATACACATTTTATTCTCAATGGGTAAAAAGCCTGAACTCACCG,Eurofins,del_stm1_F GTAGAACACTGTTATTGGATTCTTTCAGTTGGAATTATTCATATATAAGGCTTATTCCTTTGCCCTCGGACGAGTG,Eurofins,del_stm1_R GAAATTAATACGACTCACTATA,Eurofins,T7-IVT-F GTTGTTGTATCAAAATTATC,Eurofins,TSV-IRES-R TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATTACGCCAGAATGCGTTCGC,Eurofins,Nluc-pA-IVT-R RECOMBINANT

(16) Fufang Huangbo Formula mitigates myeloproliferative neoplasms by activating p53/p21 signaling axis and inhibiting STAT3 and NF-κB signaling pathwaysPharm Sci AdvApril 16, 2026Mingjie Liu, Yanxia Li, Chengxue Qin, Lingling Wang, Meiqi Guo, Yi Wang, Qian Zhou, Zhida Shi, Weimin Hao, Yuan Li, et al.16 h, and luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega E1910). 2.13 Immunoblotting Protein extraction was carried out in RIPA buffer with a protease/phosphatase

(17) WTAP stabilized by USP7 contributes to enzalutamide resistance in prostate cancer via mediating AKT m6A-modificationCancer Gene TherApril 14, 2026Ruxue Shi, Kai Gu, Haichuan Li, Qingwei Sun, Xinyu Wu, Shuhong Huang, Qingxia Huplasmids. The luciferase activity was assessed utilizing the dual-luciferase reporter gene detection kit (E1910, Promega, USA). Chromatin immunoprecipitation (ChIP) assay ChIP experiment was performed according

(18) INDETERMINATE DOMAIN 9 negatively regulates rice crown root developmentFront Plant SciApril 13, 2026Yuanyuan Yang, Zihao Shi, Xuan Nie, Yuehang Meng, Zhixun Chu, Wenjing Zou, Qingmei Jian, Deyan Zhu, Ting Zhangin transient transformation was performed by using the Dual-Luciferase® Reporter Assay Kit (Promega, E1910). Electrophoretic mobility shift assay Single-stranded complementary oligonucleotide fragments containing

(19) Secretory VSMC-derived THBS1 promotes macrophage M1 polarization and inflammation in intracranial aneurysms via the CD47/NF-κB axisFront ImmunolApril 10, 2026Jianhuang Huang, Qixiu Wang, Yangyang Lin, Jianning Chen, Caihou Linand luciferase activities were measured using the Dual-Luciferase® Reporter Assay System (Promega, E1910) on a GloMax luminometer (Promega, E5311). Relative NF-κB transcriptional activity was expressed as

(20) GV1001 Reprograms CD47 Immune Checkpoint to Restore Macrophage Antitumor Activity in Oral Squamous Cell CarcinomaInt J Mol SciApril 7, 2026Wei Chen, Seojin Kim, Cheyenne Beheshtian, Angela Jun, Sangjae Kim, No-Hee Parkdual-luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, cat. no. E1910, Madison, WI, USA) according to the manufacturer’s instructions. Relative luciferase activity was calculated

Write a Review

(1)

4/24/2020Consistent Quality with this Luciferase Reporter Kit Elva ZhangConsistent readout with this kit. Recommended.
(1)

12/27/2018Dual-Luciferase Reporter Assay System Barbara MoahamedThis reporter system was used in conjunction with an SRF-RE/firefly luciferase reporter construct to monitor the ability of a pharmaceutical compound to stimulate G12/G13 signalling in the AT1 ... Read Review
(1)

2/20/2018Convenient Dual-Luciferase Reporter Assay Kit F. BiotaThe biological importance of non-coding DNA has recently emerged given the identification of single nucleotide polymorphisms (SNPs) in these regions. While regulatory regions that control gene ... Read Review
(1)

7/19/2017Dual-Luciferase® Reporter Assay System Lana JagannathanOur lab studies ways to enhance killing of HIV-infected cells by effector cells. We use target cells that have firefly reporter and infect with a virus that expresses Renilla luciferase reporter. We ... Read Review
(1)

6/2/2016Luciferase Assay junyan taoThe activities of firefly and Renilla luciferases are measured sequentially from a single sample and the Renilla is used as the inter control to calculate the relativity changes on the interaction ... Read Review
(1)

1/7/2016Dual Luciferase Reporter, Promega Ganesh PusapatiPrimary cilia are tiny microtubule based structures that project from the cell surface. These structures serve as the signaling hubs for the Sonic hedgehog signaling. The goal of this experiment is ... Read Review
(1)

11/3/2015Lucifersae Assay Somasundaram RaghavanReporter systems are generally used to study eukaryotic gene expression. These dual reporters are generally used for experimental accuracy. Basically here we can express as well as measure the two ... Read Review

Dual-Luciferase Reporter Assay System From Promega
The luciferase assay is one of the most well-known and convenient reporter assays. In particular, ... Read More
Dual-Luciferase® Reporter Assay System from Promega
Genetic reporters such as firefly luciferase are commonly used in molecular and cellular biology ... Read More
Dual-Luciferase® Reporter Assay System From Promega
The Dual-Luciferase® Reporter (DLR™) Assay System is widely used for performing two reporter assays.... Read More

Dual-Luciferase Reporter Assay System

Dual-Luciferase Reporter Assay System from Promega

Description

Promega

Citations (4622)

Reviews

Product Reviews

Dual-Luciferase Reporter Assay System From Promega

Dual-Luciferase® Reporter Assay System from Promega

Dual-Luciferase® Reporter Assay System From Promega

Dual-Luciferase Reporter Assay System from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map