Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Product Specs
ItemAlt-R™ CRISPR Cas9 tracrRNA
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1072532
ApplicationsGene Expression and Molecular Cloning, CRISPR
TypeCRISPR/Cas9 Vectors

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) A covalent allosteric molecular glue suppresses NRF2-dependent cancer growthCancer DiscoveryMay 1, 2026Nilotpal Roy, Tine Wyseure, I-Chung Lo, Justine Lu, Christie L. Eissler, Steffen M. Bernard, Ilah Bok, Aaron N. Snead, Albert Parker, U-Ging Lo, et al.1.5 μL of crRNA was combined with 100 μmol/L of trans-activating CRISPR RNA (tracrRNA) (IDT, cat. #1072532), heated at 95°C for 5 minutes, and cooled to room temperature. The RNP complex was formed by combining

(2) AFD Thermosensory Neurons Mediate Tactile-Dependent Locomotion Modulation in C. eleganseLifeApril 27, 2026Manuel Rosero, Jihong Bai12537100, "Commercial assay, kit",Alt-R CRISPR-Cas9 tracrRNA,"Integrated DNA Technologies (IDT, NJ)",Cat# 1072532, "Commercial assay, kit",Alt-R S.p. Cas9 Nuclease V3,"Integrated DNA Technologies (IDT, NJ)",Cat# 1081058, Sequence-based

(3) Molecular and functional dissection using CaMPARI-seq reveals the neuronal organization for dissociating optic flow-dependent behaviorsNat CommunApril 17, 2026Koji Matsuda, Chung-Han Wang, Hisaya Kakinuma, Atsushi Toyoda, Tomoya Shiraki, Koichi Kawakami, Fumi Kuboproduced by annealing custom-synthesized crRNA (Alt-R CRISPR-Cas9 crRNA, IDT) with tracrRNA (IDT, Cat# 1072532) in Nuclease-Free Duplex Buffer (IDT, Cat# 11-05-01-12) and subsequently incubated with Cas9 protein

(4) GPR75 in glutamatergic neurons regulates body weightCell ReportsMarch 24, 2026Steven C. Wyler, Surbhi Gahlot, Lara Bideyan, Kyle Brown, Jennifer K. Schiavo, Marco Galvan, Shreya Thomas, Arely Tinajero, Adan Khan, Warda Merchant, et al.Integrated DNA Technologies (IDT),Alt-R™ CRISPR-Cas9 tracrRNA,Integrated DNA Technologies (IDT),Cat# 1072532 qPCR probes: Table S1,Life Biotechnologies,N/A Genotyping primers: Table S1,Integrated DNA Technologies

(5) MASTR-seq enables multiplexed analysis of short tandem repeats with sequencingCell Rep MethodsMarch 23, 2026Chuanbin Su, Han-Seul Ryu, Keerthivasan Raanin Chandradoss, Thomas Malachowski, Ravi Boya, Linda Zhou, Hoa Emma Nguyen, Esteban O. Mazzoni, Kristen J. Brennand, Jennifer E. Phillips-CreminsFigure S1; Table S1). We synthesized custom lyophilized crRNAs (2 nmol each) and tracrRNA (2 nmol, IDT 1072532), resuspended them to 100 μM in 10 mM Tris-EDTA (pH 7.5), and pooled the crRNAs equally. We prepared

(6) Lipid asymmetry disruption by XKR8 orchestrates neutrophil extracellular trap formation and inhibits fungal infectionNature ImmunologyMarch 4, 2026Weixiang Liu, Jieming Ping, Lishan Deng, Ke Wang, Jinnuo Xu, Ningxin Peng, Mengyun Yang, Hesen Tang, Zhengjie Liu, Wenliang Wang, et al.HL-60 cells. Transduced cells were selected using puromycin (1 μg ml−1). In addition, CRISPR–Cas9 tracrRNA (1072532), Cas9-GFP V3 (10008100) and corresponding CRISPR–Cas9 crRNA were purchased from IDT. The Cas9–GFP protein,

(7) Protocol to study the role of endogenously produced itaconate using CRISPR-Cas9 technology in THP-1 cellsSTAR ProtocolsMarch 1, 2026Luke A. Bourner, Katie A. Acken, Haiyan Long, Linda A. Chung, Kenneth D. Roth, Frank C. DorseyTechnologies),Cat#1081061 crRNA,IDT,Cat#ACOD1.1AC Nuclease-Free IDTE,IDT,Cat#11-01-02-02 tracrRNA,IDT,Cat#1072532 Electroporation Enhancer,IDT,Cat#1075916 10X Tris/Glycine/SDS running buffer,Bio-Rad,Cat#161-0732 1X

(8) ROME, an ancient gene with a novel function in vertebrates, is a key modulator of embryonal development and cancer metastasisCancer Research CommunicationsMarch 1, 2026Anna Molotkova, Emre Deniz, Matthew Swift, Eric Glasgow, Junfeng Ma, Jeffrey A. Petro, Isabel Frye, Metin Ozdemirli, Dusan Pesic, Gerard P. Ahern, et al.Technologies (IDT): 5′-TAAGACGTATGCTTTCACCGTGG-3′ (PAM not included in oligo). The crRNA and tracrRNA (1072532; IDT) were resuspended in duplex buffer (IDT) at 100 mmol/L and annealed by mixing 1:1 to make a 50

(9) Integrating natural and engineered genetic variations to decode regulatory influence on blood traitsCell ReportsFebruary 24, 2026Manuel Tardaguila, Dominique Von Schiller, Michela Colombo, Ilaria Gori, Eve L. Coomber, Thomas Vanderstichele, Paola Benaglio, Chiara Chiereghin, Sebastian Gerety, Dragana Vuckovic, et al.Addgene_140025 pMD2.G,Addgene,Addgene#12259; RRID: Addgene_12259 psPAX2,Addgene,Addgene#12260; RRID: Addgene_12260 tracrRNA,IDT,Cat#1072532 "See Table S7 for oligos used in MPRA, GenIE and CRISPR/Cas9 knock in of rs139141690",–,N/A ,, Software

(10) Experience-dependent reconfiguration of thermoreceptors regulates neuronal response plasticityCurrent BiologyFebruary 23, 2026Nathan Harris, Priya Dutta, Nikhila Krishnan, Stephen Nurrish, Emily C. Wilder, Piali SenguptaHydrochloride,Sigma-Aldrich,Cat# L9756 Alt-R S.p. Cas9 Nuclease V3,IDT,Cat# 1081059 Alt-R CRISPR-Cas9 tracrRNA,IDT,Cat# 1072532 Deposited data,, Raw data,This study,https://doi.org/10.6084/m9.figshare.30822701 Experimental models:

(11) A pilot study for whole proteome tagging in C. elegansbioRxivFebruary 14, 2026Matthew Eroglu, Oliver Hobertstored at −80°C until use. tracrRNA was ordered from IDT (Alt-R® CRISPR-Cas9 tracrRNA, 20 nmol, Cat: 1072532), resuspended in the provided nuclease-free duplex buffer to 0.4 μg/μl (18 μM), aliquoted, and stored

(12) Chromatin-mediated anticipatory control of type I interferon production in plasmacytoid dendritic cellsImmunityFebruary 10, 2026Nicholas M. Adams, Aleksandra Galitsyna, Ioanna Tiniakou, Eduardo Esteva, Ai C. Ra, Simon Ullrich, Stephen T. Yeung, Yanjun Tan, Joseph N. Pucella, Igor Dolgalev, et al.paper,N/A Alt-R CRISPR-Cas9 Negative Control crRNA #1,IDT,Cat# 1072544 Alt-R CRISPR-Cas9 tracrRNA,IDT,Cat# 1072532 "BAC clones RP23-64G11, RP23-139P14 and RP23-360M23",BACPAC Resources,N/A Software and algorithms,Software

(13) Identification of an uncharacterized gene as a mitochondrial methionine tRNA synthetase in Caenorhabditis elegansG3: Genes, Genomes, GeneticsFebruary 4, 2026Bharat Vivan Thapa, Mohit Das, David I Taylor, James P Held, Maulik R Patelpreviously described (Dokshin et al. 2018) using Alt-R S.p. Cas9 Nuclease V3 (IDT #1081058), tracrRNA (IDT #1072532), and using dpy-10 as a co-injection marker (Paix et al. 2015). The crRNA sequence used for introducing

(14) Functional Annotation of De Novo Variants Found Near GWAS Loci Associated With Cleft Lip With or Without Cleft PalateBirth Defects ResearchFebruary 1, 2026Sarah W. Curtis, Laura E. Cook, Kitt Paraiso, Axel Visel, Justin L. Cotney, Jeffrey C. Murray, Terri H. Beaty, Mary L. Marazita, Jenna C. Carlson, Elizabeth J. Leslie‐Clarksonconcentration 20 ng/uL), hybridzed sgRNA against the H11 locus (Alt-R CRISPR-Cas9 tracrRNA, IDT, Cat#1072532 and Alt-R CRISPR-Cas9 locus targeting crRNA, gctgatggaacaggtaacaa, total final concentration 50 ng/μL)

(15) Efficient CRISPR-Cas genome editing in brown algaeCell Reports MethodsJanuary 26, 2026Cláudia Martinho, Masakazu Hoshino, Morgane Raphalen, Viktoriia Bukhanets, Anagha Kerur, Kenny A. Bogaert, Rémy Luthringer, Susana M. Coelho"Alt-R™ S.p. HiFi Cas9 Nuclease V3, 500 μg",IDT,Cat# 1081061 "Alt-R™ CRISPR-Cas9 tracrRNA, 5 nmol",IDT,Cat# 1072532 Polyethylene glycol 4000,Sigma,Cat# 8.07490 Polyethylene glycol 8000,Fisher BioReagents,Cat#10407773 Nuclease

(16) c-JUN enhances CRISPR knockin anti-B7-H3 CAR T cell function in small cell lung cancer and thoracic SMARCA4-deficient undifferentiated tumorsCell Reports MedicineJanuary 20, 2026Hyatt Balke-Want, Vimal Keerthi, Maria Del Carmen Arenas, Yiyun Chen, Meena Malipatlolla, Dorota D. Klysz, Peng Xu, Katie Ho, Kyle Asano, David Stahl, et al.Biologicals,Cat# 535-Hl CryoStor CS10,STEMCELL Technologies,Cat# 07930 Alt-R.Sp. Cas9 protein,IDT,Cat# 1072532 CTS™ Xenon™ Genome Editing Buffer,Thermo Fisher Scientific,Cat# A4998001 "Electroporation Buffer,

(17) GPR156 is required in sensory hair cells for proper auditory and vestibular functionScientific ReportsJanuary 17, 2026Amandine Jarysta, Brandie Morris Verdone, Elli I. Hartig, Kathleen E. Cullen, Basile Tarchiniusing the crRNA: tracrRNA duplex format as the gRNA species (IDT, USA). Alt-R CRISPR-Cas9 crRNAs (#1072532) were synthesized using the gRNA sequences and hybridized with the Alt-R tracrRNA (#1072534) as per

(18) Characterization and Phenotypic Assessment of Zebrafish Disease Models for Splice Modulation StudiesMethods in Molecular BiologyJanuary 7, 2026Holly R. Thomas, Katherine G. English, Matthew S. Alexander, John M. ParantAlt-R™ S.p. Cas9 Nuclease V3 (Cat # 1081058 Integrated DNA Technologies, Coralville, IA) Alt-R® CRISPR-Cas9 tracrRNA (Cat# 1072532 Integrated DNA Technologies, Coralville, IA) Alt-R® CRISPR-Cas9 crRNA (CRISPR guide RNA) (Integrated

(19) Decoding the biogenesis of HIV-induced CPSF6 puncta and their fusion with the nuclear speckleeLifeJanuary 6, 2026Chiara Tomasini, Celine Cuche, Selen Ay, Maxence Collard, Bin Cui, Mohammad Rashid, Shaoni Bhattacharjee, Bruno Tello-Rubio, Julian Buchrieser, Charlotte Luchsinger, et al.and SON,AUM BioTech,Supplementary file 1, Sequence-based reagent,Alt-R CRISPR–Cas9 tracrRNA,IDT,# 1072532, Sequence-based reagent,Alt-R CRISPR–Cas9 crRNA,IDT,Materials and methods, "Peptide, recombinant protein",BamHI-HF,New England BioLabs

(20) A stem cell knockout village reveals lineage rewiring and a non-canonical islet cell fate in monogenic diabetesbioRxivJanuary 2, 2026Dingyu Liu, Bicna Song, Zhaoheng Li, Stephen Zhang, Tabassum Fabiha, Jiahui Zhao, Ayaka Inoki, Julie Piccand, Chew-Li Soh, Gary Dixon, et al.to excise the entire enhancer. crRNAs and tracrRNA were ordered from IDT (Alt-R® CRISPR-Cas9 crRNA, #1072532) and diluted to 15 nM final concentration. RNA molecules were transiently transfected into hPSCs using

Be the First to Write a Review!

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (313)

Reviews

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map