Lambda Exonuclease from New England Biolabs

Product Specs
ItemLambda Exonuclease
CompanyNew England Biolabs
Price $76.00 Inquire
Catalog NumberM0262S
Quantity1000 units
Concentration5,000 units/ml
ApplicationsDNA Manipulation
TypeEnzymes
Temperature-20 C

Specifications/Features

Unit Definition:
One unit is defined as the amount of enzyme required to produce 10 nmol of acid-soluble deoxyribonucleotide from double-stranded substrate in a total reaction volume of 50 µl in 30 minutes at 37°C in 1X Lambda Exonuclease Reaction Buffer with 1 µg sonicated duplex [3H]-DNA.

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) CRISPR/Cas14a combined with RPA for visual detection of Marek’s disease virusMicrobiology SpectrumMarch 3, 2026Zhi-Jian Zhu, Meng-Li Cui, Yu Liu, Xi-Qiao Yao, Meng-Jie Lu, Ming-Cheng Wang, Jun-He Liu, Jin-Feng Li, En-Zhong Liinhibitor (no. M0314S, New England Biolabs), 100 nM ssDNA reporter (Table 1), 0.6 μL λ Exonuclease (no. M0262S, New England Biolabs), and Cas14a detection buffer (1×). Fluorescence kinetics were monitored at 37°C

(2) State-specific enhancer landscapes govern microglial plasticityImmunityFebruary 10, 2026Nicole Hamagami, Dvita Kapadia, Kia M. Barclay, Yanlong Huang, Nora Abduljawad, Zuolin Cheng, Liam McLaughlin, Darsh Singhania, Xukai Ding, Jin Yang, et al.0.1uM ISPCR Oligo (AAGCAGTGGTATCAACGCAGAGT), 0.056U Lambda Exonuclease (5U/uL, New England BioLabs M0262S) to each well (PCR protocol - (1) 37°C 30 min; (2)95°C 3 min; (3) 23 cycles of 98°C 20 s, 67°C 15 s,

(3) Genome-wide regulon of NtrC reveals genetic regulation under nitrogen limitation in Methylomonas sp. DH-1iScienceJanuary 16, 2026Sukjae Han, Joon Young Park, Yong Hee Han, Ina Bang, Hyeonwoo Mun, Ok Kyung Lee, Ji Sung Hyung, Jeong-Geol Na, Eun Yeol Lee, Donghyuk Kim, et al.,New England Biolabs,Cat#M2200S PreCR® Repair Mix,New England Biolabs,Cat#M0309S Lambda Exonuclease,New England Biolabs,Cat#M0262S RecJ Exonuclease,New England Biolabs,Cat#M0264S phi29 DNA Polymerase,New England Biolabs,Cat#M0269S T4 DNA Polymerase

(4) Tubulin autoregulation factors SCAPER and TTC5 recruit γ-tubulin to non-centrosomal MTOCs for neuronal microtubule nucleation and axon regenerationbioRxivOctober 17, 2025Yi Xie, Alessandro Comincini, Chengye Feng, Carrie Ann Davison, Marc Hammarlund, Francesca Bartolini, Shaul Yogevphosphate was added to one of the oligo strands which was treated by Lambda exonuclease (NEB catalog #M0262S) for degradation. The purified ssDNA was added to the injection mix. The mixture was centrifuged at

(5) Computational design of potent and selective binders of BAK and BAXScience AdvancesSeptember 5, 2025Stephanie Berger, Erinna F. Lee, Tiffany J. Harris, Sharon Tran, Asim K. Bera, Lauren Arguinchona, Alex Kang, Banumathi Sankaran, Sila Kasapgil, Michelle S. Miller, et al.exonuclease I (2 U/μl) and Lambda exonuclease (0.25 U/μl; New England Biolabs, catalog no. M0293S and M0262S) for 90 min at 30°C and plasmid DNA purified with a QIAquick kit (QIAGEN, catalog no. 28104). DNA was

(6) Single cell and spatial alternative splicing analysis with Nanopore long read sequencingNat CommunJuly 19, 2025Yuntian Fu, Heonseok Kim, Sharmili Roy, Sijia Huang, Jenea I. Adams, Susan M. Grimes, Billy T. Lau, Anuja Sathe, Hanlee P. Ji, Nancy R. Zhangdistilled water (42.5 μL) was combined with Lambda exo buffer (5 μL) and Lambda exo nuclease (2.5 μL) (M0262S, New England Biolabs). The mixture was incubated at 37 °C for 1 h, followed by the addition of 1 μL

(7) Rewiring of 3D chromatin topology orchestrates transcriptional reprogramming in muscle fiber-type specification and transformationNat CommunJuly 1, 2025Baohua Tan, Linjun Hong, Liyao Xiao, Jiajin Wu, Geyan Lu, Shanshan Wang, Langqing Liu, Enqin Zheng, Gengyuan Cai, Zicong Li, et al.h. After ligation, the nuclei with in situ proximity ligation were treated with l-exonuclease (NEB, M0262S) and exonuclease I (NEB, M0293V) for 1 h at 37 °C to remove noise DNA contain no ligation DNA or bridge

(8) Sequence and parent-of-origin dependent m6A contribute to allele-specific gene expressionThe EMBO JournalJune 3, 2025Ying Zhang, Ze-Yu Zhang, Hong-Xuan Chen, Chao Liu, Biao-Di Liu, Ye-Lin Lan, Ying-Yuan Xie, Tao Chen, Shaobo Chen, Guihai Feng, et al.for 2 h, followed by 4 °C overnight. To remove redundant adapter, 2 µl of Lambda Exonuclease (NEB, #M0262S) and 1 µl of 5′ Deadenylase (NEB, #M0331S) were added to each ligation mix. The reaction was incubated

(9) Interpreting regulatory mechanisms of Hippo signaling through a deep learning sequence modelCell GenomApril 9, 2025Khyati Dalal, Charles McAnany, Melanie Weilert, Mary Cathleen McKinney, Sabrina Krueger, Julia ZeitlingerProtein A,ThermoFisher,10008D phi29 DNA polymerase,New England Biolabs,M0269S Lambda exonuclease,New England Biolabs,M0262S Q5 High-Fidelity 2x Master Mix,New England Biolabs,M0492S dNTP solution mix,New England Biolabs,N0447S RNase A

(10) Specific Aspects of SELEX Protocol: Different Approaches for ssDNA GenerationMethods ProtocApril 6, 2025Alexandr Garanin, Andrey Shalaev, Lidia Zabegina, Ekaterina Kadantseva, Tatiana Sharonova, Anastasia Malekexonuclease and 10× exonuclease reaction buffer (both from New England Biolabs, Frankfurt, Germany, Cat.no.: M0262S);Ethyl alcohol 96%;PCR-grade water (Biolabmix Ltd., Novosibirsk, Russia, Cat.no.: SP010-05),PCR master

(11) Systematic high-throughput evaluation reveals FrCas9's superior specificity and efficiency for therapeutic genome editingSci AdvMarch 28, 2025Rui Tian, Xun Tian, Meiying Yang, Yuping Song, Tingting Zhao, Chaoyue Zhong, Wei Zhu, Ping Zhou, Zhiqiang Han, Zheng Husequential rounds of exonuclease digestion using a cocktail of three nucleases: lambda exonuclease (NEB, M0262S), exonuclease I (NEB, M0293S), and exonuclease III (NEB, M0206S). This three-step exonuclease digestion

(12) Cell differentiation controls iron assimilation in the choanoflagellate Salpingoeca rosettamSphereMarch 25, 2025Fredrick Leon, Jesus M. Espinoza-Esparza, Vicki Deng, Maxwell C. Coyle, Sarah Espinoza, David S. Boothprimer that was 5’ phosphorylated to promote Lambda exonuclease digestion of that strand (NEB, Cat. No. M0262S) and a reverse primer with phosphorothioate bonds between the first four 5’ nucleotides to block digestion.

(13) Genome‐Wide Silencer Screening Reveals Key Silencer Modulating Reprogramming Efficiency in Mouse Induced Pluripotent Stem CellsAdvanced ScienceMarch 20, 2025Xiusheng Zhu, Lei Huang, Guoli Li, Biao Deng, Xiaoxiao Wang, Hu Yang, Yuanyuan Zhang, Qiuhan Wen, Chao Wang, Jingshu Zhang, et al.Phi29 Polymerase (Vazyme; Cat N106‐01). The blunt‐end DNA was treated with Lambda Exonuclease (NEB; Cat M0262S) to digest non‐protein‐binding DNA. After reverse‐crosslinking at 65 °C overnight, DNA was purified

(14) Post-assembly Plasmid Amplification for Increased Transformation Yields in E. coli and S. cerevisiaeChem & Bio EngineeringFebruary 27, 2025Thomas Fryer, Darian S. Wolff, Max D. Overath, Elena Schäfer, Andreas H. Laustsen, Timothy P. Jenkins, Carsten Andersenone site of the selected plasmid. Furthermore, we tested whether the presence of phosphatase (NEB: M0262S) would benefit the amplification. Individual data points are shown as open circles (black), with their

(15) DAPE cloning with modified primers for producing designated lengths of 3' single-stranded ends in PCR productsPLoS OneFebruary 13, 2025Seoee Lee, Hyunyoung Kim, Aqsa, Kwangjin Jeung, Minho Won, Hyunju Rohttp://n2t.net/addgene:110403; RRID:Addgene 110403). Enzymes T5 Exonuclease (M0663S), Lambda Exonuclease (M0262S), DNA Polymerase I, Large Klenow Fragment (M0210S), T4 DNA Polymerase (M0203S), T4 DNA Ligase (M0202S),

(16) Microglial plasticity governed by state-specific enhancer landscapesbioRxivFebruary 1, 2025Nicole Hamagami, Dvita Kapadia, Nora Abduljawad, Zuolin Cheng, Liam McLaughlin, Darsh Singhania, Kia M. Barclay, Jin Yang, Zhixin Sun, Peter Bayguinov, et al.0.1uM ISPCR Oligo (AAGCAGTGGTATCAACGCAGAGT), 0.056U Lambda Exonuclease (5U/uL, New England BioLabs M0262S) to each well (PCR protocol - (1) 37°C 30 min; (2)95°C 3 min; (3) 23 cycles of 98°C 20 s, 67°C 15 s,

(17) Tn-seq profiling reveals that NodS of the beta-rhizobium Paraburkholderia phymatum is detrimental for nodulating soybeanCommunications BiologyDecember 27, 2024Paula Bellés-Sancho, Daphné Golaz, Sarah Paszti, Alessandra Vitale, Yilei Liu, Aurélien Bailly, Leo Eberl, Euan K. James, Gabriella Pessidegraded using the exonuclease ExoI (NEB, M0293L), T7 Gene 6 Exo (NEB, M0263S) and Lambda Exo (NEB, M0262S). A PCR using T23_SLXA_PAIR_AmpF_3 and SLXA_PAIR_REV_AMP primers (Supplementary Table 3) was carried

(18) Distinct structural and functional connectivity of genetically segregated thalamoreticular subnetworksCell ReportsDecember 24, 2024Nolan D. Hartley, Alexandra Krol, Soonwook Choi, Nita Rome, Kirsten Levandowski, Samuel Pasqualoni, Carter Jones, Jiawen Tian, Sihak Lee, Husang Lee, et al.Cas9 NLS, S. pyogenes",Fisher Scientific,Cat# 1194378 Lambda Exonuclease,New England Biolabs,Cat# M0262S Human RAD51,Creative Biomart,Cat# RAD51–134H DREADD agonist 21 (C21),Tocris bio-techne,Cat# 5548 Critical

(19) Interrogation of the interplay between DNA N6-methyladenosine (6mA) and hypoxia-induced chromatin accessibility by a randomized empirical model (EnrichShuf)Nucleic acids researchDecember 11, 2024Lai JC, Hsu KW, Wu KJ.(M0201S, NEB), fill-in with phi29 DNA polymerase (M0269S, NEB) and digesting with lambda exonuclease (M0262S, NEB). After a series of enzymatic reactions, DNA was eluted using an elution buffer (100 mM NaHCO3,

(20) Controlling cellular packing and hypoxia in 3D tumor spheroids via DNA interactions†Biomaterials ScienceSeptember 10, 2024Sven A. Saemundsson, Shane D. Curry, Bryce M. Bower, Ethan J. DeBoo, Andrew P. Goodwin, Jennifer N. Cha88 μL of DNA was gathered. Next, the purified DNA was digested by the lambda exonuclease from NEB (M0262S) using the protocol provided scaled up to 100 μL. After digestion, the product was ready to be used.

Be the First to Write a Review!