NEB Stable Competent E. coli (High Efficiency) from New England Biolabs

Product Specs
ItemNEB Stable Competent E. coli (High Efficiency)
CompanyNew England Biolabs
Price $352.00 Inquire
Catalog NumberC3040H
Quantity20 x 0.05 ml
ApplicationsDNA Manipulation
Cell Type (standardized)Competent Cells
SpeciesEscherichia
Temperature-80 C
Cell TypeCompetent Cells

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Streamlined synthetic regulatory cassette for efficient and photoreceptor-enriched retinal gene expressionMol Ther Nucleic AcidsSeptember 8, 2026Jae-Eun Kwon, Ye Ji Kim, Seung-Hyun Kim, Ok-Seon Kwon, Hyeon-Ki Jang, Yong-Min Choi, Hyeon-Jin Na, Namshik Han, Yibin Chun, Jung Woo Han, et al.Assembly reactions were incubated at 50°C for 15 min, transformed into competent Escherichia coli (C3040H; New England Biolabs), and screened via colony PCR. Positive clones were confirmed through Sanger sequencing

(2) Two novel kindreds with autosomal recessive STAT2 deficiencyJournal of Human ImmunitySeptember 7, 2026Verena Kienapfel, Lotte Cresens, Lucy Bizien, Julia Vasconcelos, Marwa Chbihi, Margarida Guedes, António Marinho, Anneleen Hombrouck, Marjon Wouters, Dylan Laurens, et al.cloned into the pJET 1.2/blunt cloning vector and amplified in heat shock–transformed Escherichia coli (#C3040H; New England Biolabs). Purification of 182 clones was performed with the QIAprep Spin Miniprep kit (#27104;

(3) T cell fate is dictated by different antigen-presenting cells in response to dietary versus gut epithelial self-antigenImmunityAugust 26, 2026Yixuan D. Zhou, Hailey Brown, Emily Schaffer, Gwen M. Taylor, Kay L. Fiske, Macy R. Komnick, Sebastian Lopez, Terence S. Dermody, Daria Esterházy(University of Chicago),N/A NEB Stable Competent DH5α E. coli (High Efficiency),New England Biolabs,Cat#C3040H Biological samples,, Bovine serum albumin (BSA),Thermo Fisher,Cat#BP1600-100 Normal donkey serum

(4) Virus-induced vesicular acidification enhances HIV immune evasioniScienceAugust 21, 2026Marianne E. Yaple-Maresh, Giselle G. Flores-McGregor, Gretchen E. Zimmerman, Cuie Chen, Kathleen L. Collinsvirus strains,Bacterial and virus strains ,, NEB Stable Competent E. coli,New England Biolabs,Cat. C3040H ΔGPE FLAG-Nef,This paper,N/A ΔGPE NL-GI-IRES,This paper,N/A ΔGPE NL-GI-IRES-ARF-1,This paper,N/A ΔGPE

(5) Menin-dependent megakaryocyte proliferation and fibrosis in myeloproliferative neoplasmsCancer CellAugust 10, 2026Jeremy Wen, Anitria Cotton, Rashid Mehmood, Man Mohan, Trent Hall, Amber L. Broadhurst, Kevin Zhang, Yunusa Olufadi, Guolian Kang, Bridget Marcellino, et al.strains,Bacterial and virus strains,Bacterial and virus strains Stable Competent E. coli,NEB,Cat# C3040H ,, Biological samples,, Human CD34+ cells from the peripheral blood of healthy mobilized apheresis

(6) A self-complementary recombinant adeno-associated virus vector coding for an anchorless prion protein carrying the G127V mutation extends survival in a rodent prion disease modelPLoS PathogAugust 4, 2026Thomas Zerbes, Claire Verkuyl, Cunjie Zhang, Sophie Grunnesjoe, Shehab Eid, Hamza Arshad, Wenda Zhao, Zahra Nasser, Teaghan O'Shea, Ari Bel, et al.cagcagcagacttcccttccaggggctgcccttgatgttcatgggatccgatatctagatg – 3’. The final product was then transformed into NEB Stable Competent E. coli (catalog number C3040H, New England Biolabs) and sequence verified. The self-complementary therapeutic BvPrnp and MoPrnp vectors

(7) AAV9-Mediated PTEN Gene Therapy Rescues Hepatic Pathology and Neuroanatomical Abnormalities in a Murine Model of PTEN Hamartoma Tumour SyndromePharmaceuticsJuly 27, 2026Ceren Erdem, Sophie Thomson, Noha Bahey, Jim Selfridge, Timothy Kendall, Stuart Cobb, Kamal GadallaUSA) and cloned into an AAV9 vector. Plasmids were amplified in NEB Stable Competent E. coli cells (C3040H; New England Biolabs, Ipswich, MA, USA) and purified using the QIAGEN Maxi Prep Kit (cat. no. 12963,

(8) Productive Mayaro Virus Infection Requires Host Fatty Acid Synthase for nsP1 S-palmitoylationbioRxivJuly 26, 2026Paola N. Loperena González, Adam Brynes, Bryan Perez Soto, Jacqueline Corry, Taanishi Gulati, Hannah Tsui, Nicholas M. Chesarino, Jesse J. KwiekCompetent E. coli (C2988J, NEB) and IMC constructs were transformed into NEB® Stable Competent E. coli (C3040H, NEB) selected on LB-Agar with 50 μg/mL carbenicillin, cultured overnight in LB broth at 30°C with shaking,

(9) Arc mediates intercellular tau transmission via extracellular vesiclesCellJuly 23, 2026Mitali Tyagi, Eric de Hoog, Matthew Grega, Kaelan R. Sullivan, Alicia C. Walker, Radhika Chadha, Ava Northrop, Balázs Fábián, Gerhard Hummer, Monika Fuxreiter, et al.strains,Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency),New England Biolabs,Cat# C3040H Rosetta 2 Competent Cells,Sigma-Aldrich,Cat# 71402-4 Adeno associated virus 2/5: hSyn-eGFP-2A-2N4R

(10) Ketamine persists within neuronal compartments long after systemic clearanceResearchSquareJuly 22, 2026Joseph Cichon, Kallol Bera, Zachary Blumenfeld, Elaine Lin, Meah Ahmed, Eve Fine, Md. Nadim Hossain, Andrey Andreev, Altyn Rymbek, Peter Fenton, et al.TOP10,Thermo Fisher Scientific,C404050,Electrocompetent NEB® Stable Competent E. coli (High Efficiency),NEB,C3040H,Chemically competent Dpn1,NEB,R0176S,Restriction enzyme BamHI,NEB,R0136S,Restriction enzyme PstI,NEB,R0140S,Restriction

(11) Development of tandem canine CAR T cells to enable comparative studies of aggressive B-cell lymphomaMol Cancer TherJuly 22, 2026Brandon Peng, Lang Jiang, Jennifer A. Lenz, Luiza Cesar Conti, Antonia Rotolo, Nicola J. Mason, Matthew J. Athertoncloned into MSGV1 by Genscript. All plasmids were expanded in Stable Competent E. coli cells (Cat no. C3040H, New England Biolabs) prior to purification using Maxi Endo Free Plasmid Kit (Cat no. 12362, Qiagen).

(12) Protocol for one-step design of a triple sgRNA-based CRISPR/Cas9 construct for neuronal gene knockout in the mouse brainSTAR ProtocJuly 21, 2026Gibson Dowd, Yuki OgawaAB_1500825) ,, Bacterial and virus strains,Bacterial and virus strains,Bacterial and virus strains ,, NEB stable,NEB,C3040H ,, "Chemicals, peptides, and recombinant proteins","Chemicals, peptides, and recombinant proteins","Chemicals,

(13) Targeted antibody-drug conjugates for rhabdomyosarcoma and other FGFR4-expressing cancersCell Rep MedJuly 21, 2026Meijie Tian, Katrina Jia, Jerry T. Wu, Adam T. Cheuk, Siteng Fang, Victor T. Ojo, Eleanor G. Pope, David Milewski, Yong Yean Kim, Hsien-Chao Chou, et al.strains,Bacterial and virus strains ,, NEB® Stable Competent E. coli (High Efficiency),New England Biolabs,C3040H ,, Biological samples,Biological samples,Biological samples ,, Human breast cancer tissue microarrays,Tissuearray.Com,BR1506 Human

(14) Robust regulatory interplay of enhancers, facilitators, and promoters in a native chromatin contextCellJuly 17, 2026Zhou Zhou, Yang Cheng, Jaret Lieberth, Junke Zhang, Yiyang Jin, Albert Li, Haiyuan Yu, Abdullah Ozer, John T. Lisstrains,Bacterial and virus strains,Bacterial and virus strains NEB Stable competent E. coli cells,NEB,Cat#C3040H One Shot™ ccdB Survival™ 2 T1R Competent Cells,Thermo Fisher,Cat#A10460 "Chemicals, peptides, and

(15) Acute in vivo proximity labeling for membrane targeted proteomics in neuronal circuitsbioRxivJuly 16, 2026Maribel Anguiano, Run Zhang, Melanie Robles, Kaden P. Adams, Michelle R. Salemi, Brett S. Phinney, Christopher S. Leung, Ethan M. Fenton, Kuldeep Giri, Elinor Lewis, et al.reactions (E2611S, NEB). Plasmids were heat shock transformed into NEB Stable Competent Escherichia coli (C3040H, NEB) following the manufacturer’s protocol. Plasmids were amplified using a Plasmid Miniprep Kit (27106,

(16) Chronic stress unleashes an intratumor phage-fibroblast-B cell circuit to promote tumor growthCancer CellJuly 13, 2026Hilal Bashir, Katherine Z. Sanidad, Purnima Ravisankar, Kelly M. Banks, Avipsa Bose, Shui Yu, Joshua J.C. McGrath, Hannah C. Carrow, Taeyul K. Kim, Chloe A. Troxell, et al.al.79,– 5-alpha Competent E. coli,New England Biolabs,C2987H Stable Competent E. coli,New England Biolabs,C3040H Klebsiella pneumoniae (C8A-Human CRC normal colon derived),This study,– Klebsiella pneumoniae (T8B-Human

(17) A dynamic RNA hub facilitates activation-induced cytidine deaminase recruitment to the immunoglobulin heavy-chain locusMolecular CellJuly 2, 2026Mariia Mikhova, Mackenzie Kapanka, Li Han, Gergely Ungor, Jens C. Schmidt, Kefei YuElectroMAX DH10B Cells,ThermoFisher Scientific,Cat# 18290015 NEB Stable Competent E. coli,New England Biolabs,Cat# C3040H "Chemicals, peptides, and recombinant proteins","Chemicals, peptides, and recombinant proteins","Chemicals,

(18) Intrinsic promoter responsiveness dictates sensitivity to transcriptional activation by enhancersbioRxivJune 29, 2026Yingxuan Tan, Judhajeet Ray, Maya U. Sheth, Benjamin R. Doughty, William J. Greenleaf, Jesse M. Engreitzassembled pool of vectors, we next transformed 2 uL into 50 uL of NEB Stable Competent E. coli cells (C3040H) by thawing cells for 10 mins, heat shocking at 42 C for 30 s, placing on ice for 5 mins, and pipetting

(19) Mutant KRAS-driven selective mRNA translation reveals mechanisms and therapeutic vulnerabilities in cancerCell ReportsJune 23, 2026Ankita Shrivastava, Eric Nels Pederson, Trang Uyen Nguyen, Jacky Chuen, Prathibha Mohan, Shivangi Pande, Ana Ruiz Toribio, Nicolas Lecomte, Jerry Melchor, John C. McAuliffe, et al.and virus strains,Bacterial and virus strains Stable Competent E. coli (High Efficiency),NEB,Cat# C3040H Biological samples,Biological samples,Biological samples Human PDAC Organoids HPO-12,"Dr. Nicolas

(20) L1CAM signaling through planar cell polarity drives SOX2 expression and lung adenocarcinoma metastasisNature CommunicationsJune 18, 2026Jin Suk Park, Yasemin Kaygusuz, Carson Kenum, Lan He, Mohamed I. Gatie, Xueqian Zhuang, Roshan Sharma, Ronan Chaligné, Umesh K. Bhanot, Richard P. Koche, et al.PS100093). Products were transformed into stable competent Escherichia coli cells (New England Biolabs Cat# C3040H) according to standard protocols and spread on kanamycin (Fisher Scientific Cat# BP906-5) selective

Be the First to Write a Review!