ProtoScript II Reverse Transcriptase M0368S from New England Biolabs

Product Specs
ItemProtoScript II Reverse Transcriptase
CompanyNew England Biolabs
Price $99.00 Inquire
Catalog NumberM0368S
Size4000 units
ApplicationsDNA Analysis
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(81) ILF3 prion-like domain regulates gene expression and fear memory under chronic stressiScienceMarch 17, 2023Yamashita A, Shichino Y, Fujii K, Koshidaka Y, Adachi M, Sasagawa E, Mito M, Nakagawa S, Iwasaki S, Takao K, et al.I,Lucigen,Code: N6901K SUPERase In,Thermo Fisher Scientific,Cat#AM2694 ProtoScriptII,New England Biolabs,Cat#M0368L CircLigase II,Lucigen,Code: CL9021K ,, Critical commercial assays,Critical commercial assays,Critical

(82) A parasitic fungus employs mutated eIF4A to survive on rocaglate-synthesizing Aglaia plantseLifeFebruary 28, 2023Mingming Chen, Naoyoshi Kumakura, Hironori Saito, Ryan Muller, Madoka Nishimoto, Mari Mito, Pamela Gan, Nicholas T Ingolia, Ken Shirasu, Takuhiro Ito, et al.#:639650, Commercial assay or kit,ProtoScript II Reverse Transcriptase,New England Biolabs,Cat. #:M0368L, Commercial assay or kit,HiFi DNA assembly,New England Biolabs,Cat. #:E2621, Commercial assay or kit,Ni-NTA

(83) miR-197-3p Promotes Osteosarcoma Stemness and Chemoresistance by Inhibiting SPOPLJournal of Clinical MedicineFebruary 1, 2023Jingyong Zhang, Shubao Wang, Yang Bai, Aasi Mohammad Ali, Jiewen Deng, Yushi Chen, Yonghui Fu, Ming Heof 300ng RNA was then reverse transcribed to cDNA by ProtoScript® II Reverse Transcriptase (catalog: M0368, New England Biolabs, Ipswich, MA, USA). Quantitative real-time PCR (qRT-PCR) was performed with Luna® Universal One-Step RT-qPCR Kit

(84) T7Max transcription systemJournal of biological engineeringJanuary 23, 2023Deich C, Cash B, Sato W, Sharon J, Aufdembrink L, Gaut NJ, Heili J, Stokes K, Engelhart AE, Adamala KP.Protoscript II Reverse Transcriptase Buffer, 1 μL of Protoscript II Reverse Transcriptase (200U/μL, Catalog No. M0368, New England BioLabs Inc.), 2 μL of 0.1M dithiothreitol (DTT), 1 μL of 10mM dNTP, 0.2 μL of RNase Inhibitor

(85) Transmembrane protein 135 regulates lipid homeostasis through its role in peroxisomal DHA metabolismCommunications biologyJanuary 4, 2023Landowski M, Bhute VJ, Grindel S, Haugstad Z, Gyening YK, Tytanic M, Brush RS, Moyer LJ, Nelson DW, Davis CR, et al.using an Oligo d(T)18 primer (#S1316S, NEB, Ipswich, MA) and the ProtoScript II Reverse Transcriptase (#M0368L, NEB, Ipswich, MA) following the manufacturer’s protocol. Expression of each gene was assessed in triplicate

(86) Suppression of CCL2 angiocrine function by adrenomedullin promotes tumor growthThe Journal of experimental medicineJanuary 2, 2023Nakayama A, Roquid KA, Iring A, Strilic B, Günther S, Chen M, Weinstein LS, Offermanns S.Spectrophotometer. Complementary DNA synthesis was performed using the ProtoScript II Reverse Transcription kit (M0368S; New England BioLabs). Quantitative real-time PCR was performed using primers designed with the online

(87) Protocol to colonize gnotobiotic mice in early life and assess the impact on early life immune programmingSTAR protocolsDecember 16, 2022Lynn MA, Ryan FJ, Tee YC, Lynn DJ.(https://www.nebiolabs.com.au/protocols/2016/04/26/first-strand-cdna-synthesis-standard-protocol-neb-m0368).a.Mix 1 μg of RNA with buffer, Oligo dTs, dNTPs, as per manufacturer’s instructions (Table 4).b.Denature

(88) Tracking cryptic SARS-CoV-2 lineages detected in NYC wastewaterNature CommunicationsDecember 1, 2022Davida S. Smyth, Monica Trujillo, Devon A. Gregory, Kristen Cheung, Anna Gao, Maddie Graham, Yue Guan, Caitlyn Guldenpfennig, Irene Hoxie, Sherin Kannoly, et al.wastewater was used to generate cDNA using ProtoScript® II Reverse Transcriptase kit (New England Biolabs, M0368S). The RNA was incubated with an RBD specific primer (ccagatgattttacaggctgcg, Genewiz) and dNTPs (0.5

(89) A versatile active learning workflow for optimization of genetic and metabolic networksNature CommunicationsDecember 1, 2022Amir Pandi et al.(iTaq Universal SYBR Green Supermix Bio-Rad #1725120) when converted to cDNA by ProtoScript® II Reverse Transcriptase (NEB #M0368) using the standard protocol and random hexamer primers (ThermoFisher #SO142), but not in control reactions

(90) Aryl hydrocarbon receptor and Krüppel like factor 10 mediate a transcriptional axis modulating immune homeostasis in mosquitoesScientific ReportsDecember 1, 2022Aditi Kulkarni, Ashmita Pandey, Patrick Trainor, Samantha Carlisle, Wanqin Yu, Phanidhar Kukutla, Jiannong Xu(Invitrogen, AM1906). The cDNA synthesis was carried out using NEB ProtoScript II Reverse Transcriptase (NEB, M0368S). The cDNA was used as a template for RT-PCR, to determine transcript abundance for various genes. The

(91) Implementing wastewater surveillance for SARS‐CoV‐2 on a university campus: Lessons learnedWater Environment ResearchNovember 13, 2022Brian A. Wartell, Camila Proano, Lena Bakalian, Devrim Kaya, Kristen Croft, Michael McCreary, Naomi Lichtenstein, Victoria Miske, Patricia Arcellana, Jessica Boyer, et al.(Zymo Research, Irvine, CA, USA) and was converted to cDNA according to the methods outlined in the NEB #M0368 Standard Protocol (New England Biolabs, 2020). It was then processed and analyzed by RT‐qPCR via the

(92) Genetic context effects can override canonical cis regulatory elements in Escherichia coliNucleic Acids ResearchOctober 14, 2022Scott A Scholz, Chase D Lindeboom, Peter L FreddolinoReverse transcription for RT-qPCR was performed using NEB Protoscript II Reverse Transcriptase (product # M0368, New England Biolabs, Ipswich, MA). qPCR then used the BioRad iTaq Universal SYBR Green Supermix (product

(93) Rolling circle reverse transcription enables high fidelity nanopore sequencing of small RNAPLOS ONEOctober 10, 2022Sean Maguire, Shengxi Guan(AMV; NEB M0277), Moloney Murine Leukemia Virus RT (MMLV; NEB M0253), ProtoScript II RT (PSII; NEB M0368), SuperScript IV RT (SSIV; Thermofisher; Waltham, MA), WarmStart RTx (RTx; NEB M0380), Thermostable

(94) A custom library construction method for super-resolution ribosome profiling in ArabidopsisPlant MethodsOctober 4, 2022Hsin-Yen Larry Wu, Polly Yingshan HsuOligo Clean & Concentrator kit. Next, reverse transcription was carried out with ProtoScript II (NEB M0368L) and a reverse transcription primer whose sequence at the 3’ end was complementary to the linker. The

(95) The transcription factor Bach2 negatively regulates murine natural killer cell maturation and functioneLifeOctober 3, 2022Li S, Bern MD, Miao B, Fan C, Xing X, Inoue T, Piersma SJ, Wang T, Colonna M, Kurosaki T, et al.GSE83978 and GSE77857. For qPCR, cDNA was synthesized by ProtoScript II Reverse Transcriptase (NEB, M0368S, Ipswich). Pre-designed primers for indicated genes were obtained from IDT. Quantitative real-time PCR

(96) Chaperone requirements for de novo folding of Saccharomyces cerevisiae septinsMolecular biology of the cellOctober 1, 2022Hassell D, Denney A, Singer E, Benson A, Roth A, Ceglowski J, Steingesser M, McMurray M.(≤500 ng) was used to generate cDNA using Protoscript II Reverse Transcriptase (New England Biolabs #M0368) and the standard first-strand cDNA synthesis protocol. Reverse transcriptase (RT)-PCR with OneTaq (New England Biolabs

(97) Microtubule integrity regulates budding yeast RAM pathway gene expressionFrontiers in Cell and Developmental BiologySeptember 12, 2022Cameron Howard Lee, Sue Bigginsoligo dT primer (Thermo Fisher Scientific #FERSO132) and Protoscript II (200 μ/μl; New England Biolabs #M0368L) in a 20 μl reaction for 30 min at 50°C. Samples were diluted to 120 μl with dH2O prior to qRT-PCR that

(98) Development of a ribosome profiling protocol to study translation in Kluyveromyces marxianusFEMS Yeast ResearchSeptember 12, 2022Darren A Fenton, Stephen J Kiniry, Martina M Yordanova, Pavel V Baranov, John P MorrisseyT4 RNA ligase 2, truncated K227Q (#M0351L, NEB). The footprints were reverse transcribed using ProtoScript II (#M0368L, NEB). cDNA products were circularized using CircLigase II (#CL9025K, Epicentre/Lucigen). The major

(99) Multifarious Translational Regulation during Replicative Aging in YeastJournal of FungiSeptember 5, 2022Tianyu Zhao, Asaka Chida, Yuichi Shichino, Dongwoo Choi, Masaki Mizunuma, Shintaro Iwasaki, Yoshikazu OhyaJapan), 5 mM MgCl2 (Nacalai Tesque, Cat. # 20942-34), 1 mM dithiothreitol (New England Biolabs, Cat. # M0368L, New England Biolabs Inc., Ipswich, MA, USA), 100 µg/mL cycloheximide (Sigma-Aldrich, Cat. # C4859-1ML),

(100) Integrated analysis of small RNAs, transcriptome and degradome sequencing reveal the drought stress network in Agropyron mongolicum KengFrontiers in Plant ScienceAugust 18, 2022Bobo Fan et al.Indianapolis, IN, United States). The reverse transcription was amplified with reverse transcriptase (m0368; New England Biolabs, Ipswich, MA, United States). The degradation group sequencing library was built

Be the First to Write a Review!

ProtoScript II Reverse Transcriptase

ProtoScript II Reverse Transcriptase from New England Biolabs

New England Biolabs

Citations (188)

Reviews

ProtoScript II Reverse Transcriptase from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map