H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit FMC001 from R&D Systems, a Bio-Techne Brand

Product Specs
ItemH/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit
CompanyR&D Systems, a Bio-Techne Brand
Price $839.00Supplier Page View Company Product Page
Catalog NumberFMC001
Quantity25 Tests
ReactivityHuman, Mouse
Detection TargetPluripotent Stem Cells
StorageStore the unopened product at 2 - 8 °C. Do not use past expiration date
ApplicationsFlow Cytometry

Specifications/Features

Available conjugates: Sizes Available: 25 Tests

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) The V-ATPase/ATG16L1 axis drives membrane remodeling during epithelial morphogenesisNature CommunicationsMay 25, 2026Gabriel Baonza, Tatiana Alfonso-Pérez, Carlos Quintana-Quintana, Gonzalo Herranz, Carmen Gordillo-Vázquez, Yara El Mazjoub, L. M. Escudero, David G. Míguez, Elisa Martí, Nuria Martínez-Martín, et al.used. Pluripotency analysis The H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit (Biotechne, FMC001) was used. Western blot Pellets of cells were lysed in buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl,

(2) In Situ Detection of Kidney Organoid Generation From Stem Cells Using a Simple Electrochemical MethodAdvanced ScienceJuly 1, 2022Intan Rosalina Suhito, Jin Won Kim, Kyeong‐Mo Koo, Sun Ah Nam, Yong Kyun Kim, Tae‐Hyung Kimanalysis was performed using a human/mouse PSC multi‐color flow cytometry kit (R&D Systems, Catalog No. FMC001). The hiPSCs were harvested and washed with PBS. The pellet was immediately resuspended in a 10% NBF

(3) Generation of a human induced pluripotent stem cell line KUMi006 from a patient with multiple myelomaStem cell researchMay 1, 2022Hong JH, Kim JH, Kang KW, Lee BH, Park Y, Kim BS.

(4) Generation and characterization of a human iPSC line SANi007-A from a patient with a heterozygous dominant mutation in ELANEStem cell researchAugust 1, 2021Aarts CEM, Varga E, Webbers S, Geissler J, von Lindern M, Kuijpers TW, van den Akker E.

(5) Generation and characterization of a human iPSC line SANi006-A from a Gray Platelet Syndrome patientStem cell researchAugust 1, 2021Aarts CEM, Varga E, Webbers S, Geissler J, von Lindern M, Kuijpers TW, van den Akker E.

(6) Generation and characterization of a human iPSC line SANi008-A from a Chédiak-Higashi Syndrome patientStem cell researchAugust 1, 2021Aarts CEM, Varga E, Webbers S, Geissler J, von Lindern M, Kuijpers TW, van den Akker E.

(7) Generation and characterization of a control and patient-derived human iPSC line containing the Hermansky Pudlak type 2 (HPS2) associated heterozygous compound mutation in AP3B1Stem cell researchJuly 1, 2021Aarts CEM, Karampini E, Wüst T, Webbers S, Varga E, Geissler J, Voorberg J, von Lindern M, Bierings R, van den Akker E, et al.

(8) Modelling heme-mediated brain injury associated with cerebral malaria in human brain cortical organoidsScientific reportsDecember 16, 2019Harbuzariu A, Pitts S, Cespedes JC, Harp KO, Nti A, Shaw AP, Liu M, Stiles JK.

(9) Generation of the induced human pluripotent stem cell lines CSSi009-A from a patient with a GNB5 pathogenic variant, and CSSi010-A from a CRISPR/Cas9 engineered GNB5 knock-out human cell lineStem cell researchOctober 1, 2019Malerba N, Benzoni P, Squeo GM, Milanesi R, Giannetti F, Sadleir LG, Poke G, Augello B, Croce AI, Barbuti A, et al.

(10) Derivation of human induced pluripotent stem cell line EURACi004-A from skin fibroblasts of a patient with Arrhythmogenic Cardiomyopathy carrying the heterozygous PKP2 mutation c.2569_3018del50Stem cell researchOctober 1, 2018Ermon B, Volpato CB, Cattelan G, Silipigni R, Di Segni M, Cantaloni C, Casella M, Pramstaller PP, Pompilio G, Sommariva E, et al.

(11) Efficient Generation of Non-Integration and Feeder-Free Induced Pluripotent Stem Cells from Human Peripheral Blood Cells by Sendai VirusCellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacologyJanuary 1, 2018Ye H, Wang Q.-637 Stem Cell Multi-Color Flow Cytometry Kit Oct4-OR cgaaaaaactactcaacccct +5 ~ +25 (R&D Systems, FMC001) according to the Oct4-IR ggagagggggttaagtatttgggtttt -611 ~ -585 manufacturer’s instructions. The corresponding Oct4-IF tcactttattacccaaactaa -207

(12) Microfabric Vessels for Embryoid Body Formation and Rapid Differentiation of Pluripotent Stem CellsScientific reportsAugust 10, 2016Sato H, Idiris A, Miwa T, Kumagai H.

(13) Differentiation and transplantation of functional pancreatic beta cells generated from induced pluripotent stem cells derived from a type 1 diabetes mouse modelStem cells and developmentSeptember 20, 2012Jeon K, Lim H, Kim JH, Thuan NV, Park SH, Lim YM, Choi HY, Lee ER, Kim JH, Lee MS, et al.

(14) Generation of human induced iPSC KUMi003-A from acute promyelocytic leukemia (APL) M3Stem cell researchJanuary 1, 0001"Kim JH, Kang KW, Lee BH, Park Y, Kim BS."

(15) Generation of the human pluripotent stem cell lines KUMi005-A from a patients with multiple myelomaStem cell researchJanuary 1, 0001"Kim JH, Hong JH, Kang KW, Lee BH, Park Y, Kim BS."

Be the First to Write a Review!

H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit

H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit

H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit

H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit

H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit

H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit from R&D Systems, a Bio-Techne Brand

Specifications/Features

R&D Systems, a Bio-Techne Brand

Citations (15)

Reviews

H/M Pluripotent Stem Cell Multi-Color Flow Cytometry Kit from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map