Collagen I alpha 1 ELISA DY6220-05 from R&D Systems, a Bio-Techne Brand

Product Specs
ItemCollagen I alpha 1 ELISA
CompanyR&D Systems, a Bio-Techne Brand
Price $450.00Supplier Page View Company Product Page
Catalog NumberDY6220-05
NCBI Gene AliasesCAFYD, EDSARTH1, EDSC, OI1, OI2, OI3, OI4
NCBI Full Gene Namecollagen type I alpha 1 chain
StorageStore the unopened product at 2 - 8 °C. Do not use past expiration date
Detection TargetCollagen I alpha 1
ReactivityHuman
Detection Range31.20 - 2000 pg/mL
ApplicationsELISA
Quantity1 Kit (for 5 Plates)

Specifications/Features

Available conjugates: Sizes Available: 1 Kit (for 5 Plates)

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) Mandelamide Isolated from Prunus persica Flowers Attenuates TNF-α-Driven Oxidative and Inflammatory Responses in Human Skin CellsBiomoleculesMay 1, 2026Yea Jung Choi, Hee Woon Ann, So-Ri Son, Dae Sik Jang, Sullim Leeng/mL) in serum-free medium for 24 h to assess MMP-1 (CAT No. DY901B) and pro-collagen αI (CAT No. DY6220-05). All ELISA kits were purchased from R&D Systems (Minneapolis, MN, USA). Culture supernatants were collected

(2) Recapitulation of clinical and molecular hallmarks of lipid-induced hepatic insulin resistance in a zonated, vascularized human liver acinus microphysiological system during metabolic dysfunction-associated steatotic liver disease (MASLD) progressionBMC BiotechnologyApril 30, 2026Julio Aleman, Lawrence Vernetti, Mark E. Schurdak, Richard DeBiasio, Greg LaRocca, Vijay K. Yechoor, D. Lansing. Taylor, Andrew M. Stern, Mark T. Miedelefflux dilution for the hepatic and vascular chambers, respectively. COL1A1 (R&D Systems, cat. no. DY6220-05) was measured at a 1:250 and 1:100 efflux dilution for the hepatic and vascular chambers, respectively.

(3) Developing a protocol to counteract spontaneous in vitro activation of intestinal fibroblasts using design of experimentsnpj Biomedical InnovationsMarch 31, 2026Zahra Mohammadalizadeh, Samanvitha Sudi, Daniel A. Basto Moreno, Katherine Bauer Estrada, Morgenne Almonte, Kaitlin C. Fogg, Ana Maria Porrasproduct # ELH-FN1-1) and Human Pro-Collagen I alpha 1 (COL1A1) DuoSet ELISA (R&D Systems, product # DY6220-05) following the manufacturer’s instructions. At the end of the 5-day culture period, cell culture media

(4) Global molecular landscape of early MASLD progression in human obesityElifeMarch 23, 2026Qing Zhao, William De Nardo, Ruoyu Wang, Yi Zhong, Umur Keles, Gabriele Sakalauskaite, Li Na Zhao, Huiyi Tay, Sonia Youhanna, Mengchao Yan, et al.primers,TCTGAAGACATCCTTATTGACG Commercial assay or kit,Human Pro-collagen 1A1 DuoSet ELISA,R&D Systems,Cat. #: DY6220-05, Commercial assay or kit,DuoSet ELISA Ancillary Reagent Kit 2,R&D Systems,Cat. #: DY008B, "Chemical

(5) Global molecular landscape of early MASLD progression in human obesityeLifeMarch 23, 2026Qing Zhao, William De Nardo, Ruoyu Wang, Yi Zhong, Umur Keles, Gabriele Sakalauskaite, Li Na Zhao, Huiyi Tay, Sonia Youhanna, Mengchao Yan, et al.primers,TCTGAAGACATCCTTATTGACG Commercial assay or kit,Human Pro-collagen 1A1 DuoSet ELISA,R&D Systems,Cat. #: DY6220-05, Commercial assay or kit,DuoSet ELISA Ancillary Reagent Kit 2,R&D Systems,Cat. #: DY008B, "Chemical

(6) In Vitro and Clinical Evaluation of the Anti-Wrinkle Efficacy of Medipep-6PN, a Novel Peptide Identified by Phage DisplayInternational Journal of Molecular SciencesFebruary 11, 2026Jinho Bang, Kyuhyuk Im, Yul-Lye Hwang, Mi Yoon Kim, Jae Nam Yun, Min Youl Chang, Sunghyun Kim, Jeung-hoon Leecell culture supernatant was collected for ELISA analysis. The Human procollagen Iα1 DuoSet® ELISA kit (DY6220-05, R&D Systems, Minneapolis, MN, USA) was used, and the evaluation was performed according to the manufacturer’s

(7) Proliferation of activated hepatic stellate cells requires RESTMolecular MedicineJanuary 28, 2026Vladimir S Shavva, L. Tarnawski, W. Dai, N. Moruzzi, A.-S. Haller, F. Borg, S. Hansson, Q. Guo, M. Cai, E. Fekete, et al.biological replicates per experiment. COL1A1 concentration in media was measured using ELISA (R&D Systems, #DY6220-05) according to manufacturers instructions. Flow cytometry Primary HSCs were cultured as described above.

(8) Spatial patterning of fibroblast TGFβ signaling underlies treatment resistance in rheumatoid arthritisNature ImmunologyJanuary 15, 2026Kartik Bhamidipati, Alexa B. R. McIntyre, Shideh Kazerounian, Gao Ce, Soon W. Wong, Miles Tran, Sean A. Prell, Rachel Lau, Vikram Khedgikar, Christopher Altmann, et al.polypropylene plates before assay by ELISA. For measurement of pro-collagen 1 alpha 1 (R&D Systems, DY6220-05), COMP (R&D Systems, DY3134) or POSTN (R&D Systems, DY3548B), TGFβ1 (R&D Systems, DY240-05), TGFβ2 (R&D Systems

(9) Lymphocyte Activation Gene 3 Regulation of Profibrotic Cytokines and Type I Collagen Production in Patients With Systemic SclerosisACR Open RheumatologyJanuary 11, 2026Maithri Aspari, Stinne Greisen, Malene Hvid, Voon H. Ong, Christopher P. Denton, David Abraham, Bent Deleuran[ELISA] kit # BMS2211; Invitrogen), type 1 procollagenα (Human Pro‐Collagen I alpha 1 DuoSet ELISA Cat.DY6220‐05; R&D Systems), and fibronectin (Human Fibronectin DuoSet ELISA Cat. DY1918‐05; R&D Systems) in the plasma

(10) Telomerase modRNA Offers a Novel RNA-Based Approach to Treat Human Pulmonary FibrosisAging cellNovember 1, 2025Ye JL, Grieger K, Lu D, Brandenberger C, Juchem M, Jordan M, Oehlsen L, Zardo P, Werlein C, Hesse C, et al.

(11) Developing a Cell Culture Protocol to Induce Quiescence in Intestinal Fibroblasts Using Design of Experiments Statistical OptimizationResearch SquareOctober 29, 2025Zahra Mohammadalizadeh, Katherine Bauer Estrada, Morgenne Almonte, Kaitlin C. Fogg, Ana M. Porrascommercially available Human Fibronectin ELISA Kit (RayBiotech) and Human Pro-Collagen I alpha 1 DuoSet ELISA (DY6220–05, R&D Systems) following the manufacturer’s instructions. At the end of the 5-day culture period, cell culture media

(12) Distinctive Gene Expression Profiles and Biological Responses of Skin Fibroblasts to Nicotinamide Mononucleotide: Implications for Longevity Effects on SkinBiomedicinesSeptember 29, 2025Seongsu Kang, Jiwon Park, Eunbyul Cho, Dohyun Kim, Sanghyun Ye, Eui Taek Jeong, Seung-Hyun Jun, Nae-Gyu Kangwere collected after 48 h. The Human Pro-Collagen I alpha 1 ELISA kit was obtained from R&D Systems (DY6220-05, Minneapolis, MN, USA). The collagen synthesis rate at each time point was calculated using the following

(13) Mechanostimulatory cues determine intestinal fibroblast fate and profibrotic remodeling in a physiodynamic human gut-on-a-chipbioRxiv : the preprint server for biologyJune 11, 2025Min S, Than N, Shin YC, Ertugral EG, Kothapalli CR, Awoniyi O, Kim HJ.

(14) MicroRNA Sequencing of Serum Exosomes Reveals miR205-5p as an Anti-Fibrogenic Factor Against Intestinal Fibrosis in Crohn's DiseaseInternational journal of molecular sciencesApril 17, 2025Xie Y, van Daelen M, Park R, Almaraz I, Fontenot L, Rieder F, Ho W, Limketkai B, Shih DQ, Wei M, et al.(PPC1010, Sigma, Burlington, MA, USA) for ELISA. We utilized ELISA to measure protein levels of ProCOL1A1 (DY6220-05, R&D Systems, Minneapolis, MN, USA) and ZEB1 (MBS774017, MyBioSource, San Diego, CA 92195-3308 USA)

(15) Development and Characterization of PEGylated Poly D,L-Lactic Acid Nanoparticles for Skin RejuvenationNanomaterials (Basel)March 20, 2025Seunghwa Lee, Hyoung-Wook Moon, Seong-Jin Lee, Jin-Cheol ChoAssay The amount of newly synthesized collagen was measured by Human Pro-Collagen I alpha 1 DuoSet ELISA (DY6220-05, R&D Systems, Minneapolis, MN, USA). A plate of 96 wells was coated with the Pro-Collagen I alpha 1

(16) Fibrosis in PCLS: comparing TGF-β and fibrotic cocktailRespir ResJanuary 28, 2025Carlos Machahua, Thomas M. Marti, Patrick Dorn, Manuela Funke-Chambourand human fibronectin were measured in the supernatant and protein lysate from PCLS by ELISA kit (#DY6220-05 and #DY1918-05, respectively, R&D Systems), following the manufacturer’s protocol. Dilution determination

(17) Chemogenomic Screening in a Patient‐Derived 3D Fatty Liver Disease Model Reveals the CHRM1‐TRPM8 Axis as a Novel Module for Targeted InterventionAdvanced ScienceNovember 28, 2024Sonia Youhanna, Aurino M. Kemas, Shane C. Wright, Yi Zhong, Britta Klumpp, Kathrin Klein, Aikaterini Motso, Maurice Michel, Nicole Ziegler, Mingmei Shang, et al.measured in culture supernatants using the Human Pro‐collagen I alpha 1 DuoSet ELISA (R&D Systems; DY6220‐05) following the manufacturer's protocol. For cytokine quantifications, multiplex bead‐array immunoassays

(18) TFC‐1326 Compound Reduces Clinical Signs of Skin Aging. Evidence From In Vitro Human Adipose and Skin Models and Pilot Clinical TrialJournal of Cosmetic DermatologyNovember 17, 2024Géraldine Deliencourt‐Godefroy, Jocelyne Legoedec, Marion Bourdens, Noémie Juin, Linh‐Trang Nguyen, Marie‐Christine Branchet, Sylvie Boisnic, Mayoura Keophiphathrecommendations: IL‐6 (Duoset DY206, R&D Systems), MCP1 (Duoset, DY279‐05, R&D Systems), Procollagen I (Duoset, DY6220‐05, R&D Systems), and Hyaluronic Acid (HA) (Duoset, DY3614‐05, R&D Systems). Values were normalized to

(19) A New TGF-β Mimetic, XEP™-716 Miniprotein™, Exhibiting Regenerative Properties Objectivized by Instrumental EvaluationDermatology and TherapyNovember 1, 2024Hanane Chajra, Thibaut Saguet, Corinne Granger, Lionel Breton, Pedro Contreiras Pinto, Mickael Machicoane, Jean Marc Le Doussalharvested and frozen. Procollagen-1 was quantified using the Human Pro-collagen Iα1/COLIA1 assay kit (Cat#DY6220-05, Bio-Techne). Hyaluronic acid levels were quantified using the Hyaluronan Quantikine ELISA kit (Cat#DHYALO,

(20) Fibrillar extracellular matrix produced by pericyte-like cells facilitates glioma cell disseminationBrain pathology (Zurich, Switzerland)November 1, 2024Vymola P, Garcia-Borja E, Cervenka J, Balaziova E, Vymolova B, Veprkova J, Vodicka P, Skalnikova H, Tomas R, Netuka D, et al.were analyzed in tissue and cell lysates using DuoSet ELISA kits (DuoSet Human collagen I, cat. No. DY6220‐05 and DuoSet Human Fibronectin, cat. No. DY1918‐05 R&D Systems, USA), according to the manufacturer's

Be the First to Write a Review!

Human Pro-Collagen I alpha 1 DuoSet ELISA

Collagen I alpha 1 ELISA

Collagen I alpha 1 ELISA

Collagen I alpha 1 ELISA from R&D Systems, a Bio-Techne Brand

Specifications/Features

R&D Systems, a Bio-Techne Brand

Citations (100)

Reviews

Collagen I alpha 1 ELISA from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map