Human Pro-Collagen I alpha 1 DuoSet ELISA DY6220-05 from R&D Systems, a Bio-Techne Brand

Product Specs
ItemHuman Pro-Collagen I alpha 1 DuoSet ELISA
CompanyR&D Systems, a Bio-Techne Brand
Price $450.00Supplier Page View Company Product Page
Catalog NumberDY6220-05
Quantity1 Kit (for 5 Plates)
ApplicationsELISA
Detection Range31.20 - 2000 pg/mL
ReactivityHuman
Detection TargetCollagen I alpha 1
StorageStore the unopened product at 2 - 8 °C. Do not use past expiration date
NCBI Full Gene Namecollagen type I alpha 1 chain
NCBI Gene AliasesCAFYD, EDSARTH1, EDSC, OI1, OI2, OI3, OI4

Add to Compare List

R&D Systems, a Bio-Techne Brand

614 McKinley Place N.E.

Minneapolis, Minnesota 55413

United States

Phone: 1 (800) 343-7475
1 (612) 379-2956

Fax: 1 (612) 656-4400

Company Profile

Website: http://www.rndsystems.com

(1) Developing a protocol to counteract spontaneous in vitro activation of intestinal fibroblasts using design of experimentsnpj Biomedical InnovationsMarch 31, 2026Zahra Mohammadalizadeh, Samanvitha Sudi, Daniel A. Basto Moreno, Katherine Bauer Estrada, Morgenne Almonte, Kaitlin C. Fogg, Ana Maria Porrasproduct # ELH-FN1-1) and Human Pro-Collagen I alpha 1 (COL1A1) DuoSet ELISA (R&D Systems, product # DY6220-05) following the manufacturer’s instructions. At the end of the 5-day culture period, cell culture media

(2) Global molecular landscape of early MASLD progression in human obesityeLifeMarch 23, 2026Qing Zhao, William De Nardo, Ruoyu Wang, Yi Zhong, Umur Keles, Gabriele Sakalauskaite, Li Na Zhao, Huiyi Tay, Sonia Youhanna, Mengchao Yan, et al.primers,TCTGAAGACATCCTTATTGACG Commercial assay or kit,Human Pro-collagen 1A1 DuoSet ELISA,R&D Systems,Cat. #: DY6220-05, Commercial assay or kit,DuoSet ELISA Ancillary Reagent Kit 2,R&D Systems,Cat. #: DY008B, "Chemical

(3) In Vitro and Clinical Evaluation of the Anti-Wrinkle Efficacy of Medipep-6PN, a Novel Peptide Identified by Phage DisplayInternational Journal of Molecular SciencesFebruary 11, 2026Jinho Bang, Kyuhyuk Im, Yul-Lye Hwang, Mi Yoon Kim, Jae Nam Yun, Min Youl Chang, Sunghyun Kim, Jeung-hoon Leecell culture supernatant was collected for ELISA analysis. The Human procollagen Iα1 DuoSet® ELISA kit (DY6220-05, R&D Systems, Minneapolis, MN, USA) was used, and the evaluation was performed according to the manufacturer’s

(4) Proliferation of activated hepatic stellate cells requires RESTMolecular MedicineJanuary 28, 2026Vladimir S Shavva, L. Tarnawski, W. Dai, N. Moruzzi, A.-S. Haller, F. Borg, S. Hansson, Q. Guo, M. Cai, E. Fekete, et al.biological replicates per experiment. COL1A1 concentration in media was measured using ELISA (R&D Systems, #DY6220-05) according to manufacturers instructions. Flow cytometry Primary HSCs were cultured as described above.

(5) Spatial patterning of fibroblast TGFβ signaling underlies treatment resistance in rheumatoid arthritisNature ImmunologyJanuary 15, 2026Kartik Bhamidipati, Alexa B. R. McIntyre, Shideh Kazerounian, Gao Ce, Soon W. Wong, Miles Tran, Sean A. Prell, Rachel Lau, Vikram Khedgikar, Christopher Altmann, et al.polypropylene plates before assay by ELISA. For measurement of pro-collagen 1 alpha 1 (R&D Systems, DY6220-05), COMP (R&D Systems, DY3134) or POSTN (R&D Systems, DY3548B), TGFβ1 (R&D Systems, DY240-05), TGFβ2 (R&D Systems

(6) Lymphocyte Activation Gene 3 Regulation of Profibrotic Cytokines and Type I Collagen Production in Patients With Systemic SclerosisACR Open RheumatologyJanuary 11, 2026Maithri Aspari, Stinne Greisen, Malene Hvid, Voon H. Ong, Christopher P. Denton, David Abraham, Bent Deleuran[ELISA] kit # BMS2211; Invitrogen), type 1 procollagenα (Human Pro‐Collagen I alpha 1 DuoSet ELISA Cat.DY6220‐05; R&D Systems), and fibronectin (Human Fibronectin DuoSet ELISA Cat. DY1918‐05; R&D Systems) in the plasma

(7) Telomerase modRNA Offers a Novel RNA-Based Approach to Treat Human Pulmonary FibrosisAging cellNovember 1, 2025Ye JL, Grieger K, Lu D, Brandenberger C, Juchem M, Jordan M, Oehlsen L, Zardo P, Werlein C, Hesse C, et al.

(8) Distinctive Gene Expression Profiles and Biological Responses of Skin Fibroblasts to Nicotinamide Mononucleotide: Implications for Longevity Effects on SkinBiomedicinesSeptember 29, 2025Seongsu Kang, Jiwon Park, Eunbyul Cho, Dohyun Kim, Sanghyun Ye, Eui Taek Jeong, Seung-Hyun Jun, Nae-Gyu Kangwere collected after 48 h. The Human Pro-Collagen I alpha 1 ELISA kit was obtained from R&D Systems (DY6220-05, Minneapolis, MN, USA). The collagen synthesis rate at each time point was calculated using the following

(9) Mechanostimulatory cues determine intestinal fibroblast fate and profibrotic remodeling in a physiodynamic human gut-on-a-chipbioRxiv : the preprint server for biologyJune 11, 2025Min S, Than N, Shin YC, Ertugral EG, Kothapalli CR, Awoniyi O, Kim HJ.

(10) MicroRNA Sequencing of Serum Exosomes Reveals miR205-5p as an Anti-Fibrogenic Factor Against Intestinal Fibrosis in Crohn's DiseaseInternational journal of molecular sciencesApril 17, 2025Xie Y, van Daelen M, Park R, Almaraz I, Fontenot L, Rieder F, Ho W, Limketkai B, Shih DQ, Wei M, et al.(PPC1010, Sigma, Burlington, MA, USA) for ELISA. We utilized ELISA to measure protein levels of ProCOL1A1 (DY6220-05, R&D Systems, Minneapolis, MN, USA) and ZEB1 (MBS774017, MyBioSource, San Diego, CA 92195-3308 USA)

(11) Development and Characterization of PEGylated Poly D,L-Lactic Acid Nanoparticles for Skin RejuvenationNanomaterials (Basel)March 20, 2025Seunghwa Lee, Hyoung-Wook Moon, Seong-Jin Lee, Jin-Cheol ChoAssay The amount of newly synthesized collagen was measured by Human Pro-Collagen I alpha 1 DuoSet ELISA (DY6220-05, R&D Systems, Minneapolis, MN, USA). A plate of 96 wells was coated with the Pro-Collagen I alpha 1

(12) Fibrosis in PCLS: comparing TGF-β and fibrotic cocktailRespir ResJanuary 28, 2025Carlos Machahua, Thomas M. Marti, Patrick Dorn, Manuela Funke-Chambourand human fibronectin were measured in the supernatant and protein lysate from PCLS by ELISA kit (#DY6220-05 and #DY1918-05, respectively, R&D Systems), following the manufacturer’s protocol. Dilution determination

(13) Chemogenomic Screening in a Patient‐Derived 3D Fatty Liver Disease Model Reveals the CHRM1‐TRPM8 Axis as a Novel Module for Targeted InterventionAdvanced ScienceNovember 28, 2024Sonia Youhanna, Aurino M. Kemas, Shane C. Wright, Yi Zhong, Britta Klumpp, Kathrin Klein, Aikaterini Motso, Maurice Michel, Nicole Ziegler, Mingmei Shang, et al.measured in culture supernatants using the Human Pro‐collagen I alpha 1 DuoSet ELISA (R&D Systems; DY6220‐05) following the manufacturer's protocol. For cytokine quantifications, multiplex bead‐array immunoassays

(14) TFC‐1326 Compound Reduces Clinical Signs of Skin Aging. Evidence From In Vitro Human Adipose and Skin Models and Pilot Clinical TrialJournal of Cosmetic DermatologyNovember 17, 2024Géraldine Deliencourt‐Godefroy, Jocelyne Legoedec, Marion Bourdens, Noémie Juin, Linh‐Trang Nguyen, Marie‐Christine Branchet, Sylvie Boisnic, Mayoura Keophiphathrecommendations: IL‐6 (Duoset DY206, R&D Systems), MCP1 (Duoset, DY279‐05, R&D Systems), Procollagen I (Duoset, DY6220‐05, R&D Systems), and Hyaluronic Acid (HA) (Duoset, DY3614‐05, R&D Systems). Values were normalized to

(15) Fibrillar extracellular matrix produced by pericyte-like cells facilitates glioma cell disseminationBrain pathology (Zurich, Switzerland)November 1, 2024Vymola P, Garcia-Borja E, Cervenka J, Balaziova E, Vymolova B, Veprkova J, Vodicka P, Skalnikova H, Tomas R, Netuka D, et al.were analyzed in tissue and cell lysates using DuoSet ELISA kits (DuoSet Human collagen I, cat. No. DY6220‐05 and DuoSet Human Fibronectin, cat. No. DY1918‐05 R&D Systems, USA), according to the manufacturer's

(16) A New TGF-β Mimetic, XEP™-716 Miniprotein™, Exhibiting Regenerative Properties Objectivized by Instrumental EvaluationDermatology and TherapyNovember 1, 2024Hanane Chajra, Thibaut Saguet, Corinne Granger, Lionel Breton, Pedro Contreiras Pinto, Mickael Machicoane, Jean Marc Le Doussalharvested and frozen. Procollagen-1 was quantified using the Human Pro-collagen Iα1/COLIA1 assay kit (Cat#DY6220-05, Bio-Techne). Hyaluronic acid levels were quantified using the Hyaluronan Quantikine ELISA kit (Cat#DHYALO,

(17) A metabolic dysfunction-associated steatotic liver acinus biomimetic induces pancreatic islet dysfunction in a coupled microphysiology systemCommunications biologyOctober 14, 2024Aleman J, K R, Wiegand C, Schurdak ME, Vernetti L, Gavlock D, Reese C, DeBiasio R, LaRocca G, Angarita YD, et al.no. 126658). COL1A1 was measured using the Human pro-collagen 1A1 ELISA kit (R&D Systems, cat. no. DY6220-05) in a 1:50 efflux dilution, and TIMP1 was measured using the TIMP1 ELISA kit (R&D Systems, cat. no.

(18) Comparison of wild-type and high-risk PNPLA3 variants in a human biomimetic liver microphysiology system for metabolic dysfunction-associated steatotic liver disease precision therapyFrontiers in Cell and Developmental BiologySeptember 11, 2024Mengying Xia, Mahboubeh Varmazyad, Iris Pla-Palacín, Dillon C. Gavlock, Richard DeBiasio, Gregory LaRocca, Celeste Reese, Rodrigo M. Florentino, Lanuza A. P. Faccioli, Jacquelyn A. Brown, et al.126658). The COL1A1 level was measured using the human pro-collagen 1A1 ELISA kit (R&D Systems, cat. no. DY6220-05) in a 1:50 efflux dilution. The BUN level was measured using the Stanbio BUN Liquid Reagent for Diagnostic

(19) Wrinkle-Improving Effect of Novel Peptide That Binds to Nicotinic Acetylcholine ReceptorInternational journal of molecular sciencesJuly 18, 2024Bang J, Hwang YL, Kim MY, Yun JN, Hyun E, Chang MY, Shin DH, Kim S, Lee JH.

(20) Oxidized Phospholipids Regulate Tenocyte Function via Induction of Amphiregulin in Dendritic CellsInternational journal of molecular sciencesJuly 11, 2024Pinnarò V, Kirchberger S, Künig S, Gil Cantero S, Ciardulli MC, Della Porta G, Blüml S, Elbe-Bürger A, Bochkov V, Stöckl J.

Be the First to Write a Review!

Human Pro-Collagen I alpha 1 DuoSet ELISA

Collagen I alpha 1 ELISA

Collagen I alpha 1 ELISA

Human Pro-Collagen I alpha 1 DuoSet ELISA from R&D Systems, a Bio-Techne Brand

R&D Systems, a Bio-Techne Brand

Citations (96)

Reviews

Human Pro-Collagen I alpha 1 DuoSet ELISA from R&D Systems, a Bio-Techne Brand

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map