XBP1 Human Gene Knockout Kit (CRISPR) KN201959 from OriGene Technologies

Product Specs
ItemXBP1 Human Gene Knockout Kit (CRISPR)
CompanyOriGene Technologies
Price $1,657.00Supplier Page View Company Product Page
Catalog NumberKN201959
Quantity1 kit
NCBI Full Gene NameX-box binding protein 1
NCBI Gene AliasesTREB-5, TREB5, XBP-1, XBP2
TypeKnockout Kits (CRISPR)
Nucleic Acid TypeGene-specific Knockout Kits
Vector Type (Standardized)Plasmid
ApplicationsKnockout
Detection TargetXBP1
Vector NameGFP-puro
ReactivityHuman

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) RRM2 and CDC6 are novel effectors of XBP1-mediated endocrine resistance and predictive markers of tamoxifen sensitivityBMC cancerMarch 30, 2023Barua D, Sultana A, Islam MN, Cox F, Gupta A, Gupta S.Sigma-Aldrich, Wicklow, Ireland, unless otherwise stated. Plasmid constructs CRISPR guide RNA plasmids (Cat# KN201959) targeting XBP1 were purchased from Origene (Cambridge Biosciences, Cambridge, UK). The following plasmids:

(2) Regulated IRE1α-dependent decay (RIDD)-mediated reprograming of lipid metabolism in cancerNature communicationsMay 6, 2022Almanza A, Mnich K, Blomme A, Robinson CM, Rodriguez-Blanco G, Kierszniowska S, McGrath EP, Le Gallo M, Pilalis E, Swinnen JV, et al.sequence CCCGTCGGCCGGGTTCGGCG ((OriGene, #KN201959G2) in combination with the donor DNA (OriGene, #KN201959-D). TurboFectin transfection reagent (OriGene #TF81001) was used according to the manufacturer’s instructions

(3) XBP1 increases transactivation of somatic mutants of ESR1 and loss of XBP1 reverses endocrine resistance conferred by gain-of-function Y537S ESR1 mutationHeliyonOctober 1, 2020Barua D, Abbasi B, Gupta A, Gupta S.Sigma (Wicklow, Ireland). CRISPR guide RNA plasmids targeting XBP1 were purchased from Origene (Cat# KN201959). 2.3 Cell transfection and luciferase reporter assay Luciferase reporter assays were performed as

Be the First to Write a Review!

XBP1 Human Gene Knockout Kit (CRISPR)

XBP1 Human Gene Knockout Kit (CRISPR) from OriGene Technologies

Description

OriGene Technologies

Citations (3)

Reviews

XBP1 Human Gene Knockout Kit (CRISPR) from OriGene Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map